XLOC_015633 (trdj1)


Basic Information

Item Value
gene id XLOC_015633
gene name trdj1
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 36088431 ~ 36088479 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00031205
CCGACCCACTAACTTTCGGAGCTCCCATCCGTCTCACGGTCAATCCAAG

Function

symbol description
trdj1 Predicted to be involved in adaptive immune response. Predicted to be part of T cell receptor complex.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000098938

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00031205 True 49 TR_J_gene 0.57 1 36088431 36088479

Neighbor

gene id symbol gene type direction distance location
XLOC_015632 BX681417.25 coding upstream 652 36087769 ~ 36087779 (+)
XLOC_015631 smg7 coding upstream 8524 36046126 ~ 36079907 (+)
XLOC_015630 lamc2 coding upstream 66823 36004381 ~ 36021608 (+)
XLOC_015629 lamc2 coding upstream 86446 35991137 ~ 36001985 (+)
XLOC_015628 lamc1 coding upstream 109253 35880600 ~ 35979178 (+)
XLOC_015634 trdj2 coding downstream 179 36088658 ~ 36088717 (+)
XLOC_015635 trdc coding downstream 1181 36089660 ~ 36090680 (+)
XLOC_015636 BX681417.2 coding downstream 4474 36092953 ~ 36094319 (+)
XLOC_015637 si:dkey-161l11.67 coding downstream 6515 36094994 ~ 36095056 (+)
XLOC_015638 si:dkey-161l11.74 coding downstream 6927 36095406 ~ 36095465 (+)
XLOC_015626 BX571812.1 non-coding upstream 256986 35831329 ~ 35831445 (+)
XLOC_015623 NA non-coding upstream 474133 35612555 ~ 35614298 (+)
XLOC_015619 FP236741.1 non-coding upstream 507140 35512002 ~ 35581291 (+)
XLOC_015618 NA non-coding upstream 585498 35482156 ~ 35502933 (+)
XLOC_015616 NA non-coding upstream 872944 35146296 ~ 35215487 (+)
XLOC_015646 BX681417.3 non-coding downstream 10490 36098969 ~ 36099028 (+)
XLOC_015685 BX681417.1 non-coding downstream 28915 36117394 ~ 36117456 (+)
XLOC_015702 NA non-coding downstream 91764 36180243 ~ 36583275 (+)
XLOC_015703 NA non-coding downstream 156443 36244922 ~ 36247469 (+)

Expression


Co-expression Network