XLOC_025507


Basic Information

Item Value
gene id XLOC_025507
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 33043644 ~ 33045022 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00052351
ccttgttataaagggccgtgttgcaaacacaatttgtttgtctgtgctggagaccagaggggaagctgtctttaaaaggatggggctcttataccatatgtgaagttacctattcaggtgctttttgggcaccagtttggagatggaagacagacgaagtcaaagaagcagagaagacacatcaaccagcaaagtcttttcagatcacccaaaaatgaagattctgtcgtcatttacgcatcctcaggttgtttggacacaaagaggaatatttgatatttttattcctgtgtttaacaaaaaaaaaatcatttttaacagagctggaacaacctgagggtgagtaaatcaagatagaattttcatttttgtgtgacctaaaattgctttgaaattttacagcaccaaactgttaaat

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00052351 True 418 lncRNA 0.38 3 33043644 33045022

Neighbor

gene id symbol gene type direction distance location
XLOC_025506 NA coding upstream 94 33041307 ~ 33043550 (+)
XLOC_025505 NA coding upstream 14617 32976882 ~ 33029027 (+)
XLOC_025504 nbr1b coding upstream 91594 32933663 ~ 32952050 (+)
XLOC_025503 zgc:162613 coding upstream 173589 32862730 ~ 32870055 (+)
XLOC_025502 prr14 coding upstream 188273 32842794 ~ 32855371 (+)
XLOC_025508 CR392003.1 coding downstream 861 33045883 ~ 33048390 (+)
XLOC_025509 NA coding downstream 148346 33193368 ~ 33194715 (+)
XLOC_025510 hspb9 coding downstream 255500 33300522 ~ 33301321 (+)
XLOC_025511 pyya coding downstream 295917 33340939 ~ 33344780 (+)
XLOC_025512 mpp2a coding downstream 300325 33345347 ~ 33379440 (+)
XLOC_025429 BX649540.1 misc upstream 2794608 30248739 ~ 30249036 (+)
XLOC_025492 NA non-coding upstream 385208 32651697 ~ 32658436 (+)
XLOC_025487 FP236454.1 non-coding upstream 472273 32571309 ~ 32571371 (+)
XLOC_025481 CR936975.1 non-coding upstream 566359 32474661 ~ 32477285 (+)
XLOC_025513 CABZ01012962.1 non-coding downstream 339260 33384282 ~ 33419664 (+)
XLOC_025514 CR396582.1 non-coding downstream 362566 33407588 ~ 33407710 (+)
XLOC_025516 CR396582.2 non-coding downstream 405078 33450100 ~ 33450219 (+)

Expression


Co-expression Network