XLOC_026902 (cacng1b)


Basic Information

Item Value
gene id XLOC_026902
gene name cacng1b
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 61043774 ~ 61065055 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00052262
ATGTTGGAGGACAAGAAGACCAAGGTGAAGATAACCTTTCTGGTTATCCTGGTGGGCATTTCGTCCATGTTGGCGGCGGTGGTGACGGATCATTGGGCGGTTTTGAGTCCCAGGGTGGAGCGGCTCAATACTACCTGTGAAGCGGCACACTTTGGACTCTGGAGGCTTTGTAAAAAGAGTATCTTCATTGTGGAGGAAGACCCTCAGGGCAAAGGCTGTGGCCCTATCAGCCTGCCAGGAGTCAAGAACTGCTCCTACTTCAAGCACTTCACATCAGGGGAAGAGGCGGAAGTTTTTGAAGTCAAGACTCAGAAAGAGTACAACATCTCAGCTGCTGCCATCGCCATCTTCAGCCTGGCCTTCATGACTCTGGGCAGCCTCTGCCTGCTGGGCGCGTTTGGGAAGGGCAGAGATTACCTGCTGAGACCCGCCGGCATGTTCTTCGCTTTTGCAGGTCTGTGTATCGTCATCTCGGTGGAGGTCATGAGGCAGTCGGTCAAACGCATGATCGACAGCGACGAGACCATATGGATCGAGTACTACTATTCCTGGTCCTTCGCCTGTGCCTGCGCCGCCTTCACCCTCCTTTTTCTCAGCGGCATCACTCTACTCATCATCTCCATGCCACACATGCCCAGAAACCCCTGGGAGACCTGCATGGACGCCGAGCCCGAGCCCATAGACTAGCGGGACATCTCGACCAGAGGAACAGACACAAACATATGGGCAAAATATGCTGTTATTACTTAGAGGTTTTGTCTCG

Function

symbol description
cacng1b Predicted to enable calcium channel regulator activity. Predicted to be involved in regulation of calcium ion transmembrane transport via high voltage-gated calcium channel. Predicted to act upstream of or within calcium ion transmembrane transport and regulation of ion transmembrane transport. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be part of L-type voltage-gated calcium channel complex. Human ortholog(s) of this gene implicated in malignant hyperthermia. Orthologous to human CACNG1 (calcium voltage-gated channel auxiliary subunit gamma 1).

GO:

id name namespace
GO:0034765 regulation of ion transmembrane transport biological_process
GO:0070588 calcium ion transmembrane transport biological_process
GO:0006811 ion transport biological_process
GO:0006816 calcium ion transport biological_process
GO:1902514 regulation of calcium ion transmembrane transport via high voltage-gated calcium channel biological_process
GO:1990454 L-type voltage-gated calcium channel complex cellular_component
GO:0005891 voltage-gated calcium channel complex cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005244 voltage-gated ion channel activity molecular_function
GO:0005245 voltage-gated calcium channel activity molecular_function
GO:0005246 calcium channel regulator activity molecular_function
GO:0005262 calcium channel activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-131127-98 Predicted to enable calcium channel regulator activity. Predicted to be involved in regulation of calcium ion transmembrane transport via high voltage-gated calcium channel. Predicted to act upstream of or within calcium ion transmembrane transport and regulation of ion transmembrane transport. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be part of L-type voltage-gated calcium channel complex. Human ortholog(s) of this gene implicated in malignant hyperthermia. Orthologous to human CACNG1 (calcium voltage-gated channel auxiliary subunit gamma 1).

Ensembl:

ensembl_id ENSDARG00000052360

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00052262 True 763 mRNA 0.53 4 61043774 61065055

Neighbor

gene id symbol gene type direction distance location
XLOC_026901 NA coding downstream 87764 60949568 ~ 60956010 (-)
XLOC_026900 PITPNC1 coding downstream 155591 60862441 ~ 60888183 (-)
XLOC_026899 NA coding downstream 182629 60857022 ~ 60861145 (-)
XLOC_026898 DXO coding downstream 187617 60851049 ~ 60856157 (-)
XLOC_026897 anks4b coding downstream 216372 60812851 ~ 60827402 (-)
XLOC_026903 cacng4b coding upstream 13002 61078057 ~ 61099004 (-)
XLOC_026904 aimp2 coding upstream 43301 61108356 ~ 61116295 (-)
XLOC_026905 pvalb8 coding upstream 89164 61154219 ~ 61162750 (-)
XLOC_026906 pvalb4 coding upstream 109695 61174750 ~ 61185746 (-)
XLOC_026907 pvalb1 coding upstream 128835 61193890 ~ 61205711 (-)
XLOC_026895 NA non-coding downstream 441342 60594135 ~ 60602432 (-)
XLOC_026892 AL954150.1 non-coding downstream 592146 60451500 ~ 60451628 (-)
XLOC_026886 NA non-coding downstream 916213 60126527 ~ 60127561 (-)
XLOC_026917 NA non-coding upstream 734068 61799123 ~ 61844869 (-)
XLOC_026921 NA non-coding upstream 1134133 62199188 ~ 62201944 (-)
XLOC_026922 NA non-coding upstream 1167013 62232068 ~ 62241733 (-)
XLOC_026923 NA non-coding upstream 1187938 62252993 ~ 62333722 (-)
XLOC_026924 NA non-coding upstream 1194427 62259482 ~ 62329202 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000351_01619880_01629324 CACNG1B, CACNG1 coding CI01000351 null 1619420 ~ 1630761 (-)