XLOC_033786 (mtbl)


Basic Information

Item Value
gene id XLOC_033786
gene name mtbl
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007118.7
NCBI id CM002891.2
chromosome length 74282399
location 29148714 ~ 29149228 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00066093
ATTGGTCACACGTGATTGTGACGCACGACGGAGCGATTCCATTTAATTCCACAAGACTTCCACGAAAGCATCATACATCGTTGGACCTACGGTGTAAAGATGGACCAGTGTGACTGCTCCAAATCTGGATCTTGTAACTGCGGAGACAACTGCAAGTGCACTAACTGCTCATGCGCACACGACAAGAAAAGTTGCGGCAGTTGTCCGTCTGAGTGCAGTAAGGGCAAGAAGGACTGCGAGAGCGCGTGCAAGGACAAGGAGAAATCCTGCACCACACACTGCTGCAAATGAAGACCCTGTAATGCGCTGTGACACCACATGTGCTCCTTTAATATTAAAACCCATTCTGTCTAGTTC

Function

symbol description
mtbl Predicted to enable metal ion binding activity. Acts upstream of or within angiogenesis. Is expressed in several structures, including brain; heart; liver; medial longitudinal fasciculus; and pleuroperitoneal region.

GO:

id name namespace
GO:0001525 angiogenesis biological_process
GO:0046872 metal ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-110414-3 Predicted to enable metal ion binding activity. Acts upstream of or within angiogenesis. Is expressed in several structures, including brain; heart; liver; medial longitudinal fasciculus; and pleuroperitoneal region.

Ensembl:

ensembl_id ENSDARG00000102051

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00066093 True 357 mRNA 0.49 3 29148714 29149228

Neighbor

gene id symbol gene type direction distance location
XLOC_033785 gnao1b coding upstream 4167 29133321 ~ 29144547 (+)
XLOC_033784 tradd coding upstream 24136 29115890 ~ 29124578 (+)
XLOC_033783 ogfod1 coding upstream 38620 29096194 ~ 29110094 (+)
XLOC_033782 acd coding upstream 54409 29080684 ~ 29094305 (+)
XLOC_033781 vrk3 coding upstream 68158 29065915 ~ 29080556 (+)
XLOC_033787 tmppe coding downstream 3790 29153018 ~ 29161923 (+)
XLOC_033788 slc38a8b coding downstream 14534 29163762 ~ 29176207 (+)
XLOC_033789 aph1b coding downstream 27696 29176924 ~ 29186939 (+)
XLOC_033790 NA coding downstream 129339 29278567 ~ 29280954 (+)
XLOC_033791 si:ch211-112g6.4 coding downstream 144224 29293452 ~ 29298477 (+)
XLOC_033780 NA non-coding upstream 84317 29062175 ~ 29064397 (+)
XLOC_033770 BX323591.1 non-coding upstream 687136 28461463 ~ 28461578 (+)
XLOC_033769 BX072554.2 non-coding upstream 890088 28253644 ~ 28258626 (+)
XLOC_033768 BX005056.1 non-coding upstream 1235659 27912938 ~ 27913055 (+)
XLOC_033765 BX005056.3 non-coding upstream 1322653 27825945 ~ 27826061 (+)
XLOC_033794 NA non-coding downstream 317910 29467138 ~ 29467407 (+)
XLOC_033795 BX927082.2 non-coding downstream 353646 29502874 ~ 29506147 (+)
XLOC_033797 NA non-coding downstream 411340 29560568 ~ 29631080 (+)
XLOC_033798 CR388046.6 non-coding downstream 582026 29731254 ~ 29732610 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location