XLOC_036335


Basic Information

Item Value
gene id XLOC_036335
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 17659597 ~ 17661194 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00072020
gactcgactcgaccgcaaacaagcgccatcaccacagacaacgccgtcgtctcttcacccaacggattcatcctcgtacaagactgaagtaaaggtgaaatgactataacgttaaggtgtacctgataatagctaaagtgtgagccactgatgttgaaacactgatgctaccaatcaaccctctcttgattattaaagtcttattccttggagggtcgagtggtcatgggacctcacctggatttcacaactgactttggatctggtctgaaactgaagtatgctgaagatgccttttgcactctggaatttaagggccgtgttgcagacacaaattgtttgtctgtgctggagaccagaggggaagctgtctttaaaaggatggggctcttataccatatgtgaagttacctattcag
>TCONS_00071009
gcgccatcaccacagacaacgccgtcgtctcttcacccaacggattcatcctcgtacaagactgaagtaaaggtgaaatgactataacgttaaggtaagctctgaccttcacttaagttaacgttacggttagtcaccatcatgtatgttaattttgttcaccgtaacgttaacgttaagttagttaaataaactaaactcattatgaaacaagtcttaactgttttattaaatgaggcttataatacaattcagttgtattcttttaaactaacactaacacagtacatattgtatatttctcactggtgttaatgcagtgctaaaATTTACTAATGAGGactaattgtatattgtcactaactgtagattttattttttggtgttcaggtgtacctgataatagctaaagtgtgagccactgatgttgaaacactgatgctaccaatcaaccctctcttgattattaaaggtaatgttgaaccttcctcatttttattagatttttaaatgtcaggtttttc

Function

GO:

id name namespace
GO:0001732 formation of cytoplasmic translation initiation complex biological_process
GO:0030163 protein catabolic process biological_process
GO:0009056 catabolic process biological_process
GO:1901565 organonitrogen compound catabolic process biological_process
GO:0009057 macromolecule catabolic process biological_process
GO:1901575 organic substance catabolic process biological_process
GO:0043632 modification-dependent macromolecule catabolic process biological_process
GO:0044248 cellular catabolic process biological_process
GO:0044257 cellular protein catabolic process biological_process
GO:0044265 cellular macromolecule catabolic process biological_process
GO:0010498 proteasomal protein catabolic process biological_process
GO:0010499 proteasomal ubiquitin-independent protein catabolic process biological_process
GO:0019941 modification-dependent protein catabolic process biological_process
GO:0006508 proteolysis biological_process
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process biological_process
GO:0006511 ubiquitin-dependent protein catabolic process biological_process
GO:0051603 proteolysis involved in cellular protein catabolic process biological_process
GO:0019773 proteasome core complex, alpha-subunit complex cellular_component
GO:0005839 proteasome core complex cellular_component
GO:0005852 eukaryotic translation initiation factor 3 complex cellular_component
GO:1905368 peptidase complex cellular_component
GO:1905369 endopeptidase complex cellular_component
GO:0033290 eukaryotic 48S preinitiation complex cellular_component
GO:0000502 proteasome complex cellular_component
GO:1902494 catalytic complex cellular_component
GO:0016282 eukaryotic 43S preinitiation complex cellular_component
GO:0070993 translation preinitiation complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0070003 threonine-type peptidase activity molecular_function
GO:0004298 threonine-type endopeptidase activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDARG00000092245

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00072020 False 419 lncRNA 0.45 6 17659597 17661194
TCONS_00071009 True 524 lncRNA 0.34 3 17660185 17661172

Neighbor

gene id symbol gene type direction distance location
XLOC_036333 skia coding downstream 143149 17395929 ~ 17516448 (-)
XLOC_036332 BX465215.1 coding downstream 407243 17252239 ~ 17252354 (-)
XLOC_036331 pola2 coding downstream 475115 17174796 ~ 17184482 (-)
XLOC_036330 mrps36 coding downstream 491767 17163494 ~ 17167830 (-)
XLOC_036329 rab3c coding downstream 592233 17055292 ~ 17067364 (-)
XLOC_036336 NA coding upstream 116666 17777860 ~ 17784911 (-)
XLOC_036337 si:ch211-150o23.2 coding upstream 126114 17787308 ~ 17790965 (-)
XLOC_036338 st6galnac5b coding upstream 139186 17800380 ~ 17822259 (-)
XLOC_036339 lhx8b coding upstream 260235 17921429 ~ 17926814 (-)
XLOC_036340 tnni3k coding upstream 297225 17958419 ~ 17980317 (-)
XLOC_036322 NA non-coding downstream 1045934 16609622 ~ 16613663 (-)
XLOC_036323 CU467861.2 non-coding downstream 1047580 16611935 ~ 16612017 (-)
XLOC_036318 NA non-coding downstream 1074985 16566548 ~ 16584612 (-)
XLOC_036355 AL844185.2 non-coding upstream 923499 18584693 ~ 18584807 (-)
XLOC_036356 NA non-coding upstream 932873 18594067 ~ 18599356 (-)
XLOC_036359 NA non-coding upstream 1110413 18771607 ~ 18773009 (-)
XLOC_036374 NA non-coding upstream 2324648 19985842 ~ 19989233 (-)
XLOC_036319 NA non-coding downstream 1081847 16570519 ~ 16577750 (-)

Expression


Co-expression Network