G146757


Basic Information

Item Value
gene id G146757
gene name NA
gene type unknown
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053125.1
NCBI id CM020922.1
chromosome length 39125861
location 28399266 ~ 28401350 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU198160
GAGAGAGAAGCAGCGAAGCAGCCAAAGGTTTCTGCTGAAAGGCGACTATGTGGCTGCGAGTCTTCTTCACGCTCTTCGTCTTCAACGTCTCCGGCAGCCAGGCGGCCTCAGTGTTCCTGGACCCAGACGTGGCCCACGGGGTCCTGGTCCGGGCCCGCAGGTCCAACTCGGGCTGGCTGGAGGAGCTCCAGAAGGGGGACCTGAAGAGGGAGTGCCTGGAGGAGAGGTGCTCATTCGAGGAGGCCCGGGAGGTCTTTGAACACACCGAGAGAACG

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05133 Pertussis
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus

RNA

RNA id representative length rna type GC content exon number start site end site
TU198160 True 275 TUCP 0.63 2 28399266 28401350

Neighbor

gene id symbol gene type direction distance location
LOC120572286 NA coding upstream 13956 28382955 ~ 28385310 (+)
LOC120572284 LOC103373335 coding upstream 103284 28275398 ~ 28295982 (+)
LOC120572283 LOC103147980,LOC103369207,LOC106934234,LOC108243879 coding upstream 185234 28198923 ~ 28214032 (+)
LOC120572575 LOC108243880,LOC108243879,LOC108243890,LOC108243930,LOC108229645 coding upstream 216289 28175931 ~ 28182977 (+)
abce1 abce1 coding upstream 512857 27859806 ~ 27886409 (+)
txk txk,LOC108249159 coding downstream 8195 28409545 ~ 28446660 (+)
LOC120572276 cdkl2,LOC103363889,LOC102296890,LOC105921304 coding downstream 50643 28451993 ~ 28467121 (+)
LOC120572291 NA coding downstream 211426 28612776 ~ 28613543 (+)
LOC120572212 NA coding downstream 261270 28662620 ~ 28670821 (+)
LOC120572584 NA coding downstream 281671 28683021 ~ 28704147 (+)
LOC120572289 NA non-coding upstream 183398 28214699 ~ 28215868 (+)
G146703 NA non-coding upstream 317208 28075818 ~ 28082058 (+)
G146700 NA non-coding upstream 335973 28062803 ~ 28063293 (+)
G146699 NA non-coding upstream 345998 28051970 ~ 28053268 (+)
G146676 NA non-coding upstream 371915 27997612 ~ 28027351 (+)
G146756 NA non-coding downstream 28631 28429981 ~ 28453160 (+)
G146765 NA non-coding downstream 64093 28465443 ~ 28544749 (+)
G146778 NA non-coding downstream 119577 28520927 ~ 28529168 (+)
G146779 NA non-coding downstream 124935 28526285 ~ 28526703 (+)
LOC120572290 NA non-coding downstream 137995 28539345 ~ 28548694 (+)
G146747 NA other upstream 45598 28350866 ~ 28353668 (+)
G146739 NA other upstream 100990 28297774 ~ 28298276 (+)
LOC120572279 LOC103147982,LOC108243879,LOC108243930,LOC108243880,LOC103369207,LOC108243890 other upstream 125408 28218812 ~ 28273858 (+)
LOC120572278 NA other upstream 176135 28190844 ~ 28223131 (+)
LOC120572281 NA other upstream 230919 28158338 ~ 28168347 (+)
G146753 NA other downstream 154202 28555552 ~ 28585067 (+)
tec tec other downstream 216515 28617865 ~ 28651546 (+)
G147035 NA other downstream 628132 29029482 ~ 29065509 (+)
G147192 NA other downstream 868064 29269414 ~ 29480487 (+)
LOC120572956 NA other downstream 1012913 29414263 ~ 29421799 (+)

Expression


Co-expression Network