G20372 (chd1l)


Basic Information

Item Value
gene id G20372
gene name chd1l
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047596.1
NCBI id CM018542.1
chromosome length 35203048
location 2329407 ~ 2330884 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU24256
AGATGAACTGGACTTTCTACCTCTGCCACAATGTGCGTAACAAGTGAGCTCATGATGTCCTCTTCATCGCCATCATACGTGACGAGGTATCGTGCGAGTTTCTTTCTCTCCGTCGCCCCCACGTTGTAGAAGAACACACGGACTCCTCTCATAAAGTCGGCTAAACCGGAAGCTTCTCCGCCCTGCTGTGATGTGCTGGAACCTTCTGGAGACTCGGCTTGTTCTTCTGATGGACCAGGAGGACTGAGAGAACATGAGGAGCTGGGAGAGACTGGTGCTGGAGGAGCGAATGCTGAGCGTGAGGTAGACGGGATCGCCGTGTTCGTAGACGAAGCCGTCGTGGCGGCGTATGAAGCCGTACGCTTGTAGT

Function

symbol description
chd1l Predicted to enable nucleotide binding activity. Predicted to be involved in cellular response to DNA damage stimulus and chromatin remodeling. Predicted to act upstream of or within DNA repair. Predicted to be active in nucleus. Orthologous to human CHD1L (chromodomain helicase DNA binding protein 1 like).

NR:

description
PREDICTED: chromodomain-helicase-DNA-binding protein 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU24256 True 370 lncRNA 0.54 2 2329407 2330884

Neighbor

gene id symbol gene type direction distance location
LOC113545943 cth coding upstream 403917 1908482 ~ 1925490 (+)
nit2 nit2,LOC107582734,LOC107685305,LOC107673472 coding upstream 425098 1893746 ~ 1904309 (+)
si:dkey-66a8.7 LOC108271843 coding upstream 445217 1877922 ~ 1884190 (+)
plcxd1 plcxd1,LOC108271842,LOC103035541,LOC107673474,LOC107711026,LOC107585164,LOC108441321 coding upstream 451590 1868286 ~ 1877817 (+)
jade3 jade3,LOC107585190 coding upstream 467267 1844079 ~ 1862140 (+)
her6 hes1 coding downstream 216748 2547632 ~ 2549332 (+)
LOC113545856 LOC108271686,LOC107709064 coding downstream 321210 2652094 ~ 2661787 (+)
crbn crbn,LOC107711034,LOC107748399 coding downstream 390375 2721259 ~ 2733138 (+)
ccdc174 ccdc174 coding downstream 412279 2743163 ~ 2748673 (+)
si:dkey-28n18.9 LOC108271812 coding downstream 420341 2751225 ~ 2759178 (+)
G20208 ptger3,LOC107582843 non-coding upstream 354886 1970279 ~ 1974521 (+)
G20116 slc9a7,LOC107585158,LOC107711095,LOC107673530 non-coding upstream 521214 1806861 ~ 1808193 (+)
G20115 NA non-coding upstream 523649 1803136 ~ 1805758 (+)
G20113 NA non-coding upstream 526950 1802226 ~ 1802457 (+)
G20112 NA non-coding upstream 527551 1801642 ~ 1801856 (+)
G20401 NA non-coding downstream 35725 2366609 ~ 2368218 (+)
G20802 NA non-coding downstream 617726 2948610 ~ 2948846 (+)
G20807 NA non-coding downstream 620793 2951677 ~ 2951878 (+)
G20848 NA non-coding downstream 821430 3152314 ~ 3152514 (+)
G20856 NA non-coding downstream 879577 3210461 ~ 3210931 (+)
LOC113545932 gabrg3 other upstream 840628 1351753 ~ 1488779 (+)
cnga3a cnga3a,LOC108271559,LOC107733584,LOC108441138 other upstream 1233453 1082436 ~ 1095954 (+)
vdrb vdrb,LOC108272216,LOC107585146,LOC107673565,LOC108441087,LOC107667372,LOC107582718,LOC107733590,LOC107711077 other upstream 1326949 969957 ~ 1002458 (+)
G19395 LOC108272241 other upstream 1716681 609199 ~ 612726 (+)
LOC113545899 LOC108272223 other upstream 1770938 554222 ~ 558469 (+)
opa1 opa1,LOC107585173,LOC107722677,LOC107582739,LOC107711112,LOC107673572 other downstream 55815 2386699 ~ 2452689 (+)
vhl vhl other downstream 403228 2734112 ~ 2737993 (+)
col7a1 col7a1 other downstream 501269 2832153 ~ 2946856 (+)
trnaf-gaa_10 NA other downstream 655334 2986218 ~ 2986433 (+)
trnaf-gaa_11 NA other downstream 657919 2988803 ~ 2988875 (+)

Expression


Co-expression Network