AMCG00000086 (slc25a21,LOC107679800)


Basic Information

Item Value
gene id AMCG00000086
gene name slc25a21,LOC107679800
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 2776667 ~ 2790487 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000086
ATGGCCCTATCGGTTGCAGGGTTGGGATCGGGCCTGACTGAAGCAGTGGTGGTGAATCCCTTTGAGGTGGTCAAAGTGAGCCTGCAAGCCAACCGGGATGCATTTGCAGTGCAACCCTCAACATTTGCTCAGGCGCGACTCATCATCAGTGCCAATGGATTTGGGCTGAAGGGCCTGAACAAGGGCCTAACATCCACCCTGGGGCGCCATGGTGTGTTTAACATGATCTATTTTGGGTTCTACTTCAACGTCAAGGACATGATCCCTGCCAGTCAGGATCCCTCCTTGGAATTTCTGCGCAAGTTTGCAATTGGACTGACTTCTGGAACCATCTCGTCTTGTGTGAACATTCCTTTCGATGTAGCAAAGAGTCGCATCCAGGGCCCTCAGCCCGTGCCTGGAGAGATCAAGTACAGAACCTGCTTTCAGACCATGGTTCTGGTCTACAGGGAAGAGGGGTGA

Function

symbol description
slc25a21 Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Human ortholog(s) of this gene implicated in mitochondrial DNA depletion syndrome. Orthologous to human SLC25A21 (solute carrier family 25 member 21).

NR:

description
PREDICTED: mitochondrial 2-oxodicarboxylate carrier isoform X1

GO:

id name namespace
GO:0055085 transmembrane transport biological_process
GO:0016021 integral component of membrane cellular_component

KEGG:

id description
K15110 SLC25A21, ODC; solute carrier family 25 (mitochondrial 2-oxodicarboxylate transporter), member 21

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000086 True 462 mRNA 0.53 4 2776667 2790487

Neighbor

gene id symbol gene type direction distance location
AMCG00000074 LOC106602716,LOC107752725 coding upstream 168676 2572779 ~ 2607991 (+)
AMCG00000071 NA coding upstream 640769 2128584 ~ 2135898 (+)
AMCG00000070 tmem229b,LOC107752730,LOC107708331,LOC102785226 coding upstream 661500 2114661 ~ 2115167 (+)
AMCG00000072 mta1,LOC102776995,LOC107741866,LOC107666257 coding upstream 742025 2013547 ~ 2034642 (+)
AMCG00000067 NA coding upstream 915923 1860508 ~ 1860744 (+)
AMCG00000088 NA coding downstream 49428 2839915 ~ 2841035 (+)
AMCG00000085 nkx2.1,nkx2-1,LOC107679765,LOC107666245,LOC107582966,LOC107578306 coding downstream 67666 2858153 ~ 2860184 (+)
AMCG00000075 NA coding downstream 285698 3076185 ~ 3107875 (+)
AMCG00000078 NA coding downstream 612872 3403359 ~ 3416557 (+)
AMCG00000079 NA coding downstream 653026 3443513 ~ 3464306 (+)
G147739 NA non-coding upstream 251246 2525191 ~ 2525421 (+)
G147735 NA non-coding upstream 297709 2478710 ~ 2478958 (+)
G147689 LOC107575789 non-coding upstream 408222 2301487 ~ 2368445 (+)
G147688 NA non-coding upstream 418530 2291140 ~ 2358137 (+)
G147806 NA non-coding downstream 219596 3010083 ~ 3016145 (+)
G147807 NA non-coding downstream 229908 3020395 ~ 3021571 (+)
G147808 NA non-coding downstream 232451 3022938 ~ 3023268 (+)
G147809 NA non-coding downstream 234891 3025378 ~ 3025789 (+)
G147814 NA non-coding downstream 244532 3035019 ~ 3036346 (+)
G147726 LOC104962440 other upstream 372695 2403730 ~ 2403972 (+)
AMCG00000073 mta1,LOC107679789,LOC107666257,LOC107600838 other upstream 717897 2036023 ~ 2058770 (+)
G147416 NA other upstream 1659717 1063085 ~ 1116950 (+)
G147311 NA other upstream 2278156 449652 ~ 498511 (+)
AMCG00000032 NA other upstream 2522226 231336 ~ 254441 (+)
AMCG00000094 NA other downstream 900285 3690772 ~ 3699093 (+)
AMCG00000093 srp14,LOC106610862 other downstream 930498 3720985 ~ 3724316 (+)
G148040 NA other downstream 969692 3760179 ~ 3760624 (+)
AMCG00000113 NA other downstream 1321633 4112120 ~ 4193033 (+)
AMCG00000136 btbd7 other downstream 2297952 5088439 ~ 5161195 (+)

Expression


Co-expression Network