AMCG00000232 (meis2)


Basic Information

Item Value
gene id AMCG00000232
gene name meis2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 8108618 ~ 8120105 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000232
ATGGCGCAAAGGTACGATGAACTGCCCCACTACGGGATGGACGGGGTGGGGGTCCCGGCGTCCATGTACGGGGACCCCCACGCCCCCCGGCCGCTCCCCCAGGTGCACCACCTGAACCACGGGCCGCCGCTGCACGCGAGCCAGCACTACGGCGCCCACGCGCCCCATCCCAACGTCATGCCCACCGGCATGGGCTCCGCGGTCAACGACGTGCTCAAGAGGGACAAGGATGCCATTTATGGTCACCCGTTATTTCCCCTGCTAGCGCTGGTCTTTGAGAAGTGCGAGCTGGCGACGTGCACCCCCCGAGAGCCGGGCGTCGCGGGCGGCGACGTCTGCTCCTCCGACTCCTTCAACGAGGACATCGCCGTCTTTGCCAAACAGGTTCGAGCCGAAAAACCCTTATTTTCTTCAAATCCTGAATTGGATAATTTGATGATACAAGCCATACAAGTATTACGATTTCATCTTTTGGAATTAGAAAAGGTCCATGAGCTCTGTGATAACTTTTGCCATCGGTACATTAGCTGTCTAAAAGGAAAAATGCCCATTGATCTAGTGATCGACGAACGGGATGGCAGCTCAAAGTCGGACCACGAAGAGCTCTCAGGATCTTCCACAAACCTAGCCGACCATAACCCAGCGTCTTGGAGAGATCACGATGACGCCACCTCGACGCACTCAGCAGGCACGCCAGGACCCTCCAGTGGGGGCCACGCTTCACAAAGTGGGGACAACAGCAGTGAACAA

Function

symbol description
meis2 Enables DNA-binding transcription activator activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in positive regulation of cardiac muscle myoblast proliferation; positive regulation of mitotic cell cycle; and positive regulation of transcription by RNA polymerase II. Predicted to be located in nucleus and perinuclear region of cytoplasm. Predicted to be part of chromatin. Implicated in cleft palate, cardiac defects, and intellectual disabillity.

NR:

description
PREDICTED: homeobox protein Meis2 isoform X3

GO: NA

KEGG:

id description
K16670 MEIS2; homeobox protein Meis2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000232 True 750 mRNA 0.58 7 8108618 8120105

Neighbor

gene id symbol gene type direction distance location
AMCG00000238 NA coding upstream 222174 7871530 ~ 7886444 (+)
AMCG00000221 ino80,LOC107668207,LOC107739367,LOC107721325 coding upstream 367811 7702819 ~ 7740807 (+)
AMCG00000220 vps18,LOC106571062,LOC107739368 coding upstream 411487 7690570 ~ 7697131 (+)
AMCG00000235 NA coding upstream 434051 7663322 ~ 7674567 (+)
AMCG00000233 dcaf4 coding upstream 455290 7643721 ~ 7653328 (+)
AMCG00000247 dph6 coding downstream 304479 8424584 ~ 8426636 (+)
AMCG00000248 NA coding downstream 322198 8442303 ~ 8457288 (+)
AMCG00000245 NA coding downstream 353469 8473574 ~ 8483697 (+)
AMCG00000250 NA coding downstream 399759 8519864 ~ 8525224 (+)
AMCG00000246 NA coding downstream 407333 8527438 ~ 8550859 (+)
G149001 NA non-coding upstream 152229 7955972 ~ 7956389 (+)
G148961 NA non-coding upstream 349021 7759369 ~ 7759597 (+)
G148919 NA non-coding upstream 424521 7683878 ~ 7684097 (+)
G148791 NA non-coding upstream 1016158 7092025 ~ 7092460 (+)
G148768 NA non-coding upstream 1173458 6933300 ~ 6935160 (+)
G149055 NA non-coding downstream 463543 8583648 ~ 8584007 (+)
G149056 NA non-coding downstream 464383 8584488 ~ 8584967 (+)
G149059 NA non-coding downstream 548875 8668980 ~ 8673786 (+)
G149172 psmc6 non-coding downstream 893266 9013371 ~ 9016151 (+)
G149253 NA non-coding downstream 1159958 9280063 ~ 9285151 (+)
AMCG00000217 gpx2 other upstream 745911 7359278 ~ 7362707 (+)
AMCG00000215 max,LOC107668248,LOC103457350 other upstream 784167 7313872 ~ 7324451 (+)
AMCG00000216 srsf5b,srsf5,LOC107093669,LOC100707620,LOC102304179,LOC102202212,LOC103457348,LOC105936365,LOC105024333,LOC107756601,LOC107602033,LOC103029514,LOC103359433,LOC108233477 other upstream 811653 7290666 ~ 7296965 (+)
AMCG00000198 LOC106586563 other upstream 1587755 6500893 ~ 6520863 (+)
AMCG00000201 NA other upstream 1634386 6469345 ~ 6474232 (+)
AMCG00000251 NA other downstream 452831 8572936 ~ 8575124 (+)
AMCG00000249 acta1,actc1,LOC103383882,LOC105024319 other downstream 459612 8579717 ~ 8585273 (+)
AMCG00000285 map4k5 other downstream 1319956 9440061 ~ 9486689 (+)
AMCG00000286 sos2 other downstream 1394717 9514822 ~ 9546411 (+)
AMCG00000281 cpsf2,LOC106608196 other downstream 1441452 9561557 ~ 9591088 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000360_00239322_00269102 MEIS2 coding CI01000360 null 239126 ~ 269188 (+)