AMCG00002430 (galnt1,LOC107593713)


Basic Information

Item Value
gene id AMCG00002430
gene name galnt1,LOC107593713
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 13788543 ~ 13793190 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002430
ATGAGGAAGTTTGCCTACTGCAAAGTGGTGCTGGCCACCTCGCTGGTTTGGGTGATGCTAGACATGTTCATCCTGCTCTACTTCAGCGAATGCAACAAGTGCGAGGACAAGAAGGAGAGGGGTCTGCCTGGCCGAGATGAGGTGGTGCAGAAACCCCAGGAAGGGCCAGGGGAGATGGGCAAACCGGTGGTCATCCCCAAAGAGAACCAGGAGAAGATGAAAGAGATGTTCAAGATCAACCAGTTTAACCTCATGGCTAGCGAGATGATCGCCCTCAACAGGTCACTGCCCGACGTCCGGTTGGAGGGGTGA

Function

symbol description
galnt1 Predicted to enable carbohydrate binding activity and hexosyltransferase activity. Predicted to be involved in protein glycosylation. Predicted to be located in Golgi membrane. Predicted to be integral component of membrane. Predicted to be active in Golgi apparatus. Orthologous to human GALNT1 (polypeptide N-acetylgalactosaminyltransferase 1).

NR:

description
PREDICTED: polypeptide N-acetylgalactosaminyltransferase 1 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002430 True 312 mRNA 0.55 2 13788543 13793190

Neighbor

gene id symbol gene type direction distance location
AMCG00002431 NA coding downstream 16234 13768415 ~ 13772309 (-)
AMCG00002427 galnt1 coding downstream 29624 13756885 ~ 13758919 (-)
AMCG00002426 galnt1 coding downstream 47149 13728610 ~ 13741394 (-)
AMCG00002428 NA coding downstream 97317 13678772 ~ 13691226 (-)
AMCG00002425 glipr2 coding downstream 109827 13671349 ~ 13678716 (-)
AMCG00002432 NA coding upstream 91987 13885177 ~ 13939261 (-)
AMCG00002433 NA coding upstream 172920 13966110 ~ 13966467 (-)
AMCG00002434 NA coding upstream 197716 13990906 ~ 14043904 (-)
AMCG00002436 NA coding upstream 277595 14070785 ~ 14101399 (-)
AMCG00002435 NA coding upstream 334614 14127804 ~ 14151845 (-)
G123027 NA non-coding downstream 296926 13487114 ~ 13491617 (-)
G123014 NA non-coding downstream 331484 13455085 ~ 13457059 (-)
G122991 NA non-coding downstream 376247 13411499 ~ 13412296 (-)
G122957 NA non-coding downstream 482948 13303152 ~ 13305595 (-)
G122956 NA non-coding downstream 485461 13302120 ~ 13303082 (-)
G123152 NA non-coding upstream 285054 14078244 ~ 14111201 (-)
G123175 NA non-coding upstream 749631 14542821 ~ 14543020 (-)
G123177 NA non-coding upstream 773057 14566247 ~ 14567067 (-)
G123178 NA non-coding upstream 794024 14587214 ~ 14588758 (-)
G123179 NA non-coding upstream 795619 14588809 ~ 14594542 (-)
AMCG00002421 sec61b,LOC102796100 other downstream 134296 13649227 ~ 13654247 (-)
G122862 NA other downstream 759137 13028197 ~ 13029406 (-)
AMCG00002368 rbm24b,rbm24,rbm24a,LOC106596654,LOC107601977,LOC106517771,LOC105905339 other downstream 1782191 11995828 ~ 12006352 (-)
AMCG00002351 NA other downstream 1915681 11869607 ~ 11872862 (-)
AMCG00002350 tmem240a,tmem240,LOC107687438,LOC108275582,LOC105898995,LOC107593924,LOC107673083 other downstream 1933652 11848470 ~ 11854891 (-)
G123263 NA other upstream 1148070 14941260 ~ 14946311 (-)
G123585 NA other upstream 3042966 16836156 ~ 16839722 (-)
AMCG00002503 NA other upstream 3164972 16958162 ~ 16974301 (-)
AMCG00002524 NA other upstream 3896818 17690008 ~ 17706289 (-)
G123829 NA other upstream 4129262 17922452 ~ 17989465 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
mexican tetra (Astyanax mexicanus) G16839 galnt1,LOC107593713,LOC107657719 non-coding NC_035899.1 CM008302.1 6689720 ~ 6800136 (+)