AMCG00003516



Basic Information


Item Value
gene id AMCG00003516
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 7045216 ~ 7047403 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00003516
ATGGCTCTCCAGGGAGGACCCTCCTCCGAGCCACCACTGTGCCCCAAGAAGCAGGCTGCCTCTTTTGGGCCTCTCTCCATCCATGTGGTGGAGGAATGGCGAGTTTGTGTCGGAGTGTCTCTTGCCCGGATGGAACTTTTCCTGTTCTTCACATCTCTGTTACAGCGCTTATCTTTCCATCCTCCTAATGGTGTTGAAGAGAAAGATCTTGATCTGTCCTCTGTTGGGGCACTGTCTGTGGCCCCCCAGCCCCATTGTCTTTGTGCAGTACAGCGTTAA

Function


GO:

id name namespace
GO:0005783 endoplasmic reticulum cellular_component
GO:0031090 organelle membrane cellular_component
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen molecular_function
GO:0004497 monooxygenase activity molecular_function
GO:0046872 metal ion binding molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00003516 True 279 mRNA 0.54 2 7045216 7047403

Neighbor


gene id symbol gene type direction distance location
AMCG00003513 NA coding upstream 4307 7039811 ~ 7040909 (+)
AMCG00003507 NA coding upstream 174951 6827929 ~ 6870265 (+)
AMCG00003506 NA coding upstream 219506 6818616 ~ 6825710 (+)
AMCG00003505 NA coding upstream 308846 6723530 ~ 6736370 (+)
AMCG00003501 NA coding upstream 398514 6620811 ~ 6646702 (+)
AMCG00003523 NA coding downstream 361142 7408545 ~ 7410129 (+)
AMCG00003522 trappc12 coding downstream 375400 7422803 ~ 7438447 (+)
AMCG00003529 NA coding downstream 406008 7453411 ~ 7459476 (+)
AMCG00003527 NA coding downstream 419518 7466921 ~ 7482206 (+)
AMCG00003521 NA coding downstream 458060 7505463 ~ 7514410 (+)
G990 NA non-coding upstream 1058822 5986038 ~ 5986394 (+)
G983 NA non-coding upstream 1089396 5955604 ~ 5955820 (+)
G960 NA non-coding upstream 1215471 5829459 ~ 5829745 (+)
G908 NA non-coding upstream 1486701 5557607 ~ 5558515 (+)
G907 kbtbd11 non-coding upstream 1488910 5550745 ~ 5556306 (+)
G1146 NA non-coding downstream 26001 7073404 ~ 7073609 (+)
G1187 NA non-coding downstream 317541 7364944 ~ 7365477 (+)
G1218 NA non-coding downstream 442042 7489445 ~ 7489881 (+)
G1241 NA non-coding downstream 476458 7523861 ~ 7750465 (+)
G1242 NA non-coding downstream 479456 7526859 ~ 7528458 (+)
G1012 NA other upstream 550311 6487692 ~ 6494905 (+)
AMCG00003480 NA other upstream 1710464 5303450 ~ 5334752 (+)
AMCG00003469 NA other upstream 2522816 4514031 ~ 4522400 (+)
AMCG00003473 NA other upstream 2590074 4452564 ~ 4455142 (+)
AMCG00003524 rps7,LOC107668222 other downstream 450637 7498040 ~ 7504015 (+)
AMCG00003534 id2,LOC106566577 other downstream 1601722 8649125 ~ 8652470 (+)
AMCG00003541 asap2,LOC106566627 other downstream 1853053 8900456 ~ 8941751 (+)
AMCG00003544 NA other downstream 2028487 9075890 ~ 9106765 (+)
AMCG00003551 NA other downstream 2208425 9255828 ~ 9263468 (+)

Expression



Co-expression Network