AMCG00003542 (itgb1bp1)



Basic Information


Item Value
gene id AMCG00003542
gene name itgb1bp1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 8958141 ~ 8959534 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00003542
ATGTTCAGGACTCTACAGGAACCTCTGGACTTCATTAACTATATAGATGTGGCACAGCAAGATGGAAAGCTGCCATTTGTGCCAACAGAAGAGGAAGTGATCTTGGCAGTCTCGAAGTACGGAGTGAAGGTGGTCTCAGTGGATCAGTGCGATGTGCTGCACCGCCACCCTCTATACCTGATCGTACGCATGCTGTGCTACGACGATGGCCTGGGAGCCGGGAAAAACCTCCTGGCATTGAAAACGACTGATCCTAAGCAGCAGGAGTGCCATATCTGGGTGTACCAGTGCAGCAACTCGGATCAAGCACAAACCATCTGTAAGATGCTGTCCGCAGCCTTCGACTCCGTTCTGACATCAGAGAAATCTTGA

Function


symbol description
itgb1bp1 Predicted to act upstream of or within integrin-mediated signaling pathway. Orthologous to human ITGB1BP1 (integrin subunit beta 1 binding protein 1).

NR:

description
PREDICTED: integrin beta-1-binding protein 1

GO:

id name namespace
GO:0007229 integrin-mediated signaling pathway biological_process

KEGG:

id description
K20058 ITGB1BP1; integrin beta-1-binding protein 1

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00003542 True 372 mRNA 0.51 4 8958141 8959534

Neighbor


gene id symbol gene type direction distance location
AMCG00003535 NA coding upstream 115722 8819412 ~ 8842419 (+)
AMCG00003533 rnf144a,rnf144aa,LOC107752753,LOC106610698 coding upstream 620491 8317038 ~ 8337650 (+)
AMCG00003532 rsad2 coding upstream 665923 8284827 ~ 8292218 (+)
AMCG00003530 LOC108258189,LOC103368564,LOC106533618 coding upstream 977944 7978775 ~ 7980197 (+)
AMCG00003526 NA coding upstream 1410587 7532553 ~ 7547554 (+)
AMCG00003539 cpsf3 coding downstream 6177 8965711 ~ 8977843 (+)
AMCG00003540 NA coding downstream 20066 8979600 ~ 8982021 (+)
AMCG00003545 grhl1 coding downstream 150307 9109841 ~ 9131160 (+)
AMCG00003543 NA coding downstream 181010 9140544 ~ 9144958 (+)
AMCG00003546 rrm2,LOC107668265 coding downstream 206152 9165686 ~ 9168941 (+)
G1375 NA non-coding upstream 114059 8843827 ~ 8844082 (+)
G1347 NA non-coding upstream 257587 8699466 ~ 8700554 (+)
G1343 NA non-coding upstream 291214 8661032 ~ 8666927 (+)
G1303 NA non-coding upstream 514117 8443740 ~ 8444024 (+)
G1291 NA non-coding upstream 617549 8340266 ~ 8340592 (+)
G1430 ywhaqb,ywhaq,LOC105896734,LOC108436740,LOC107733143,LOC107674035,LOC107752793 non-coding downstream 49763 9009297 ~ 9027632 (+)
G1574 NA non-coding downstream 741023 9700557 ~ 9703478 (+)
G1706 NA non-coding downstream 1277322 10236856 ~ 10238261 (+)
G1747 ralgapa2 non-coding downstream 1472130 10431664 ~ 10457765 (+)
G1855 NA non-coding downstream 2090617 11050151 ~ 11050644 (+)
AMCG00003541 asap2,LOC106566627 other upstream 16390 8900456 ~ 8941751 (+)
AMCG00003534 id2,LOC106566577 other upstream 305671 8649125 ~ 8652470 (+)
AMCG00003524 rps7,LOC107668222 other upstream 1454126 7498040 ~ 7504015 (+)
G1012 NA other upstream 2463236 6487692 ~ 6494905 (+)
AMCG00003480 NA other upstream 3623389 5303450 ~ 5334752 (+)
AMCG00003544 NA other downstream 116356 9075890 ~ 9106765 (+)
AMCG00003551 NA other downstream 296294 9255828 ~ 9263468 (+)
AMCG00003570 NA other downstream 817974 9777508 ~ 9781756 (+)
AMCG00003604 NA other downstream 2502129 11461663 ~ 11482931 (+)
AMCG00003606 NA other downstream 2530651 11490185 ~ 11491597 (+)

Expression



Co-expression Network