AMCG00004342 (gopc,LOC106607787,LOC107603060,LOC107678854)


Basic Information

Item Value
gene id AMCG00004342
gene name gopc,LOC106607787,LOC107603060,LOC107678854
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 43610781 ~ 43611095 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004342
ATGTCTGCGACGCCCGGCGGTGTCTCCCCAGCCTCTCAGGGCTCGGCTCTTACTGGTCCCGGTTCCGGGATGACAATGTTTCGCTGGCTGGAGGTCCTGGAGAAGGAATTTGACAAAGCTTTCGTGGACGTGGATTTATTGCTCGGAGAAATAGACCCCGATCAGGCTGACATCACGTATGAGGGCCGCCAGAAGATGACCAGCCTCAGCTCCTGCTTCGCCCAGCTTTGCCACAAAGCACAGACCATCTTCCAACTGAACCACAAACTGGAGGTAAATAAGCGCCAGCAAAGCAAGTTTAAAGTGCTCATGTAA

Function

symbol description
gopc Predicted to enable transmembrane transporter binding activity. Predicted to be involved in cytoplasmic sequestering of CFTR protein and negative regulation of protein localization to cell surface. Predicted to be active in Golgi apparatus; membrane; and trans-Golgi network transport vesicle. Orthologous to human GOPC (golgi associated PDZ and coiled-coil motif containing).

NR:

description
PREDICTED: Golgi-associated PDZ and coiled-coil motif-containing protein isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004342 True 315 mRNA 0.54 1 43610781 43611095

Neighbor

gene id symbol gene type direction distance location
AMCG00004335 NA coding upstream 76123 43526980 ~ 43534658 (+)
AMCG00004332 NA coding upstream 199685 43380670 ~ 43411096 (+)
AMCG00004329 LOC107549683 coding upstream 248094 43350779 ~ 43362687 (+)
AMCG00004330 fam184a,LOC106607780,LOC106571378 coding upstream 271921 43329372 ~ 43338860 (+)
AMCG00004331 NA coding upstream 293373 43295652 ~ 43317408 (+)
AMCG00004338 LOC106571388,LOC106607787 coding downstream 14520 43625615 ~ 43631896 (+)
AMCG00004343 NA coding downstream 59925 43671020 ~ 43721979 (+)
AMCG00004346 NA coding downstream 184126 43795221 ~ 43798475 (+)
AMCG00004351 NA coding downstream 799504 44410599 ~ 44411051 (+)
AMCG00004354 NA coding downstream 887333 44498428 ~ 44498907 (+)
G7485 NA non-coding upstream 15703 43591750 ~ 43595078 (+)
G7441 NA non-coding upstream 263822 43346350 ~ 43346959 (+)
G7418 NA non-coding upstream 373128 43235818 ~ 43237653 (+)
G7293 NA non-coding upstream 1134895 42475576 ~ 42475886 (+)
G7288 NA non-coding upstream 1230820 42376625 ~ 42379961 (+)
G7569 pvrl1b,nectin1,LOC107563312,LOC107758086,LOC107691861,LOC107670612,LOC107561861 non-coding downstream 467250 44078345 ~ 44088037 (+)
G7584 NA non-coding downstream 725356 44336451 ~ 44336681 (+)
G7614 NA non-coding downstream 919245 44530340 ~ 44543143 (+)
G7638 NA non-coding downstream 963236 44574331 ~ 44574997 (+)
G7644 NA non-coding downstream 976611 44587706 ~ 44587984 (+)
G7329 fabp7,LOC108247051,LOC104945778 other upstream 919672 42688779 ~ 42691109 (+)
AMCG00004304 NA other upstream 1394419 42210430 ~ 42216362 (+)
G7094 NA other upstream 2103550 41459576 ~ 41507231 (+)
AMCG00004257 dusp10,LOC106607590 other upstream 3269546 40326410 ~ 40341235 (+)
AMCG00004210 fam49a,znf395,LOC108440968,LOC106571599,LOC107696187,LOC107553485,LOC106608122 other upstream 5763061 37832623 ~ 37847720 (+)
AMCG00004355 hyou1,LOC100380749 other downstream 1007090 44618185 ~ 44640732 (+)
AMCG00004380 NA other downstream 2350915 45962010 ~ 45968306 (+)
G7999 NA other downstream 4535793 48146888 ~ 48147156 (+)
AMCG00004421 NA other downstream 5286022 48897117 ~ 49026355 (+)
G8099 NA other downstream 5321355 48932450 ~ 48934095 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
eurasian perch (Perca fluviatilis) G28457 NA non-coding NC_053114.1 CM020911.1 19115987 ~ 19116404 (-)
mexican tetra (Astyanax mexicanus) G28231 gopc non-coding NC_035899.1 CM008302.1 54663719 ~ 54665970 (-)