G586 (mtmr9)



Basic Information


Item Value
gene id G586
gene name mtmr9
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 3596921 ~ 3599589 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU706
CAGGCACGCTGTGGTGAGGATCTCTTTGACATGAGTCAGCCAGTTGGACGCCTCCAGCTTGCTCAGCCAGCGGTCCATGTTGTGAGACTGGTCGTTGCAGGCTTCCACCAGCTTGATCAGGCTCTCCTGGAGGATACCAACCTCTCGATGGCCTTGTGGATCCTCCTCCACTGGGGGTAGTGGGCCTCCTGCTCAAACCCGCCGCCCCTGGCCTTGGCCTGCTGTGCCACATTGATGGTCCGGGTGTCGATGATGTAGCCGCGCTTGCCTGCCCGCAGCGTAGCGTTGATCAGCTTCTCATCCTCCTTGCAGCGCCGCCCGTTGGTGCCAGTCAGGGGCTGTCCGGCACGCATCATCAC

Function


symbol description
mtmr9 Predicted to enable phosphatidylinositol-3-phosphatase activity. Predicted to be involved in negative regulation of autophagy and phosphatidylinositol dephosphorylation. Predicted to be active in cytoplasm and membrane. Orthologous to human MTMR9 (myotubularin related protein 9).

NR:

description
PREDICTED: myotubularin-related protein 9 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU706 True 359 lncRNA 0.30 2 3596921 3599589

Neighbor


gene id symbol gene type direction distance location
AMCG00003443 NA coding downstream 60906 3466802 ~ 3536015 (-)
AMCG00003439 NA coding downstream 181636 3404970 ~ 3415285 (-)
AMCG00003440 NA coding downstream 196237 3398726 ~ 3400684 (-)
AMCG00003436 NA coding downstream 305694 3290037 ~ 3291227 (-)
AMCG00003437 NA coding downstream 346199 3239884 ~ 3250722 (-)
AMCG00003449 NA coding upstream 109524 3709113 ~ 3714240 (-)
AMCG00003451 NA coding upstream 253558 3853147 ~ 3855295 (-)
AMCG00003461 NA coding upstream 492503 4092092 ~ 4120379 (-)
AMCG00003464 NA coding upstream 610158 4209747 ~ 4211902 (-)
AMCG00003460 NA coding upstream 618580 4218169 ~ 4235652 (-)
G578 NA non-coding downstream 71826 3524024 ~ 3525095 (-)
G541 ccdc25 non-coding downstream 168630 3424088 ~ 3428291 (-)
G500 NA non-coding downstream 385044 3195905 ~ 3211877 (-)
G464 NA non-coding downstream 485870 3086465 ~ 3111051 (-)
G458 NA non-coding downstream 538717 3006968 ~ 3058204 (-)
G624 NA non-coding upstream 263408 3862997 ~ 3865429 (-)
G664 NA non-coding upstream 321407 3920996 ~ 3974710 (-)
G667 NA non-coding upstream 376168 3975757 ~ 3975989 (-)
G707 NA non-coding upstream 682236 4281825 ~ 4316284 (-)
G708 NA non-coding upstream 682560 4282149 ~ 4326850 (-)
AMCG00003444 NA other downstream 57954 3536172 ~ 3538967 (-)
G531 adck3,coq8a,LOC107602173,LOC107675039,LOC107727627 other downstream 166649 3394657 ~ 3430272 (-)
AMCG00003422 NA other downstream 1158100 2427397 ~ 2438821 (-)
AMCG00003423 NA other downstream 1195026 2397642 ~ 2401895 (-)
AMCG00003400 abracl,LOC107727609,LOC107558932,LOC107553474 other downstream 2639725 945223 ~ 957196 (-)
AMCG00003459 NA other upstream 276643 3876232 ~ 3895524 (-)
AMCG00003476 NA other upstream 983553 4583142 ~ 4808989 (-)
AMCG00003484 NA other upstream 1744481 5344070 ~ 5356468 (-)
AMCG00003550 NA other upstream 5409528 9009117 ~ 9082850 (-)
AMCG00003572 NA other upstream 6253610 9853199 ~ 9865649 (-)

Expression



Co-expression Network