AMCG00011298 (yipf5,LOC107713174,LOC102777143)


Basic Information

Item Value
gene id AMCG00011298
gene name yipf5,LOC107713174,LOC102777143
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 17219688 ~ 17222519 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00011298
GCTGTTGGAAATGTCAGGCTTTGACAACTTCAACACAGACTTCTACCAGACCAGCTACAGCATCGATGACCAAGCACAGCATACGTACGATTATACTAATTCGGGCGACCCATACAACAAGCCCTATGAAAACTATGACTATTCTCAGCAAGCTGGCTACGCAGCTCCAGGAATGATGCCGCCACAGCAGGCGTACACGGGTCAGATCTACCAGCCAGCCCCGACCTTCACGCCAGCCTCTTCACAGTCTATGTACGGCAGCAGTTTTGAAGATGAGCCCCCTTTACTAGAGGAATTGGGAATCAACTTTGACCACATCTGGCAGAAAACCCTGACAGTGCTGCACCCTCTCAAAGCAGCAGACGGCAGCATCATGAATGAAACAGACCTGGCTGGTCCCATGGTCTTCTGTCTGGCATTTGGAGCCACTTTATTGCTGGCTGGGAAAATACAGTTTGGATATGTATATGGGATCAGCGCGATCGGCTGTCTGGGAATGTACTGTCTGCTGAACTTGATGAGTATGACGGGTGTCTCGTTCGGCTGTGTGGCGAGCGTCCTGGGCTACTGTCTGTTGCCCATGATTATTTTATCTAGCTTCGGCGTGCTGTTCTCACTGCAAGGATTGATGGGCATTATTATCACGGCTTTCATCATTGGCTGGTGCAGTCTTTCCGCCTCCAAAATTTTCATCTCTGCTTTAGCCATGGACGGACAGCAGCTCTTAGTGGCATATCCCTGTGCGCTC

Function

symbol description
yipf5 Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport; regulation of ER to Golgi vesicle-mediated transport; and vesicle fusion with Golgi apparatus. Predicted to act upstream of or within protein transport and vesicle-mediated transport. Predicted to be located in Golgi apparatus and endoplasmic reticulum membrane. Predicted to be integral component of membrane. Predicted to be active in trans-Golgi network. Orthologous to human YIPF5 (Yip1 domain family member 5).

NR:

description
PREDICTED: protein YIPF5

GO:

id name namespace
GO:0016020 membrane cellular_component

KEGG:

id description
K20363 YIPF5_7, YIP1; protein YIPF5/7

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00011298 True 748 mRNA 0.50 5 17219688 17222519

Neighbor

gene id symbol gene type direction distance location
AMCG00011296 NA coding upstream 200382 17009308 ~ 17019306 (+)
AMCG00011295 NA coding upstream 211402 17006454 ~ 17008286 (+)
AMCG00011288 lars,LOC102775971 coding upstream 242228 16962316 ~ 16977460 (+)
AMCG00011287 rad50,LOC107684216 coding upstream 324763 16865367 ~ 16894925 (+)
AMCG00011289 p4ha2,LOC102786823 coding upstream 376992 16827176 ~ 16842696 (+)
AMCG00011302 NA coding downstream 37496 17260015 ~ 17261217 (+)
AMCG00011300 LOC105025958 coding downstream 73024 17295543 ~ 17307824 (+)
AMCG00011309 NA coding downstream 195076 17417595 ~ 17426498 (+)
AMCG00011307 rasgef1c,LOC102777120 coding downstream 322246 17544765 ~ 17556370 (+)
AMCG00011308 LOC108441031 coding downstream 341066 17563585 ~ 17568228 (+)
G105538 NA non-coding upstream 494535 16724688 ~ 16725153 (+)
G105466 NA non-coding upstream 1019389 16200049 ~ 16200299 (+)
G105448 NA non-coding upstream 1086701 16132758 ~ 16132987 (+)
G105438 NA non-coding upstream 1152246 16067233 ~ 16067442 (+)
G105436 NA non-coding upstream 1155939 16062914 ~ 16063749 (+)
G105684 NA non-coding downstream 87240 17309759 ~ 17312068 (+)
G105715 NA non-coding downstream 156101 17378620 ~ 17378860 (+)
G105756 NA non-coding downstream 512471 17734990 ~ 17742387 (+)
G105769 NA non-coding downstream 528731 17751250 ~ 17751484 (+)
G105776 phykpl,LOC100691570 non-coding downstream 543372 17765891 ~ 17768221 (+)
AMCG00011293 plac8l1 other upstream 237447 16978492 ~ 16982241 (+)
AMCG00011268 NA other upstream 1109307 16105586 ~ 16110381 (+)
G105373 cssa04h5orf24,pcbd2,LOC105890513,LOC100699409 other upstream 1235609 15963340 ~ 15984079 (+)
AMCG00011255 LOC106603967,LOC105011194,LOC108410970 other upstream 1346199 15863032 ~ 15873489 (+)
AMCG00011252 NA other upstream 1363904 15853764 ~ 15855784 (+)
G105778 LOC105024433,LOC107752029,LOC107743918,LOC106604409 other downstream 561644 17784163 ~ 17788050 (+)
AMCG00011328 NA other downstream 1884754 19107273 ~ 19117369 (+)
G105916 NA other downstream 1999536 19222055 ~ 19222421 (+)
G106139 LOC108275110 other downstream 2872710 20095229 ~ 20162966 (+)
AMCG00011365 LOC108438827,LOC108243066,LOC107376386 other downstream 3073492 20296011 ~ 20339325 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000040_02853028_02861012 YIPF5 coding CI01000040 null 2853028 ~ 2861012 (-)