AMCG00015721 (pou4f2,LOC102790387)


Basic Information

Item Value
gene id AMCG00015721
gene name pou4f2,LOC102790387
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 18437183 ~ 18437479 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00015721
ATGATCGCGCTGAAGCCCATCCTGCAGGCGTGGCTGGAAGAGGCAGAGAAGTCGCACAGGGAGAAACTCAACAAGCCCGAGCTCTTCAATGGGGCTGAGAAGAAGAGGAAGCGCACCTCCATAGCGGCCCCAGAGAAGAGGTCCTTGGAAGCTTACTTCGCCATCCAGCCCCGTCCCTCCTCCGAGAAAATAGCAGCCATTGCGGAGAAACTGGACCTGAAAAAGAACGTGGTTCGGGTCTGGTTCTGCAACCAGCGGCAGAAACAGAAACGGATGAAATACTCGGCGTGCGCCTAG

Function

symbol description
pou4f2 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within brain development and heart development. Predicted to be located in nucleus. Is expressed in eye and rhombomere. Orthologous to human POU4F2 (POU class 4 homeobox 2).

NR:

description
PREDICTED: POU domain, class 4, transcription factor 2-like

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0007420 brain development biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00015721 True 297 mRNA 0.57 1 18437183 18437479

Neighbor

gene id symbol gene type direction distance location
AMCG00015720 LOC107565324 coding downstream 315422 18102674 ~ 18121761 (-)
AMCG00015719 NA coding downstream 364465 18071300 ~ 18072718 (-)
AMCG00015718 NA coding downstream 381268 18047191 ~ 18055915 (-)
AMCG00015717 NA coding downstream 408213 17971120 ~ 18028970 (-)
AMCG00015713 NA coding downstream 889687 17523279 ~ 17547496 (-)
AMCG00015722 pou4f2,LOC107550641,LOC101063993,LOC107670704,LOC102237073,LOC107742546 coding upstream 261 18437740 ~ 18439149 (-)
AMCG00015724 NA coding upstream 163753 18601232 ~ 18617687 (-)
AMCG00015729 mmaa,LOC106610208,LOC107550599 coding upstream 302581 18740060 ~ 18770335 (-)
AMCG00015730 smad1,LOC105020940,LOC106610220 coding upstream 337881 18775360 ~ 18783878 (-)
AMCG00015732 abce1 coding upstream 392588 18830067 ~ 18839249 (-)
G100019 LOC103376870 non-coding downstream 38162 18345234 ~ 18399021 (-)
G99997 NA non-coding downstream 292666 18144276 ~ 18144517 (-)
G99944 NA non-coding downstream 479696 17952758 ~ 17957487 (-)
G99942 NA non-coding downstream 503855 17933000 ~ 17933328 (-)
G99941 NA non-coding downstream 531727 17905037 ~ 17905456 (-)
G100038 LOC100136012 non-coding upstream 78972 18516451 ~ 18516729 (-)
G100039 NA non-coding upstream 123236 18560715 ~ 18560947 (-)
G100040 NA non-coding upstream 153973 18591452 ~ 18598196 (-)
G100102 NA non-coding upstream 298977 18736456 ~ 18737039 (-)
G100109 NA non-coding upstream 362091 18799570 ~ 18806676 (-)
G99939 NA other downstream 599241 17837580 ~ 17837942 (-)
AMCG00015694 NA other downstream 1825739 16592228 ~ 16611444 (-)
AMCG00015691 NA other downstream 1901715 16524114 ~ 16535468 (-)
AMCG00015681 NA other downstream 1964006 16467299 ~ 16473177 (-)
G99646 NA other downstream 2215028 16221765 ~ 16222155 (-)
AMCG00015723 lsm6,LOC106610200 other upstream 190126 18627605 ~ 18630665 (-)
AMCG00015752 NA other upstream 1537477 19974956 ~ 19981557 (-)
AMCG00015761 herc3 other upstream 1789888 20227367 ~ 20279644 (-)
AMCG00015800 NA other upstream 4243215 22680694 ~ 22702249 (-)
AMCG00015825 LOC106569940,LOC107700648,LOC107717728,LOC108274877,LOC107565247 other upstream 5306311 23743790 ~ 23746703 (-)

Expression


Co-expression Network