G12489 (dyrk1a,LOC107744208)


Basic Information

Item Value
gene id G12489
gene name dyrk1a,LOC107744208
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 14194935 ~ 14196634 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU15409
TGTCCCAGTTGGCAAGAGCTACCAAAGTCTACTATTTTGATGGCGCTTCGCTTAGGATTACACAGAAGGATGTTCTCGGGTTTTAAGTCACAGTGGATGATGCTGAGCTCAGGTGTGGCGAGGAACAGCAGGGCCGTGCACATCTGTTGGGCAAACTTGCGGGTCAGGTTCAGAGAGACGCCGCGGAAATTGGTGTTGCGCAGCAAGTCATAGAGGTTGTACGACAGCATCTCGAACACCAGGCAGAGGTGGTTCCTGAACATGAAGTGACGCTTCAGGTGAACTATGTAGTATTTCATCTCGGTGTCATGTTTGTTCATAAGCTCGAGGAGCCGCACTTCAATCTGGGCTTGATTCAGGAAAGCCTTCTTGTTCTTGATGATCTTAATTGCCACCCACTCCTGCTCAACACGGTCATACGCCTTTACAACCTGTCCAAACGAGCCTTTGCCTATTAAGGAATCGATTTCATAGCGGTCCATCCATTTCTCCCCG

Function

symbol description
dyrk1a Enables cytoskeletal protein binding activity; identical protein binding activity; and protein kinase activity. Involved in amyloid-beta formation; positive regulation of RNA splicing; and protein phosphorylation. Acts upstream of or within peptidyl-tyrosine phosphorylation. Located in cytoplasm and nucleus. Colocalizes with actin filament; microtubule; and neurofilament. Implicated in autism spectrum disorder; autosomal dominant non-syndromic intellectual disability 7; and intellectual disability. Biomarker of Down syndrome.

NR:

description
PREDICTED: dual specificity tyrosine-phosphorylation-regulated kinase 1A-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU15409 True 495 lncRNA 0.49 3 14194935 14196634

Neighbor

gene id symbol gene type direction distance location
AMCG00016270 NA coding upstream 17805 14176792 ~ 14177130 (+)
AMCG00016269 kcnj6 coding upstream 32507 14161493 ~ 14162428 (+)
AMCG00016265 erg,LOC106567682 coding upstream 110442 14069281 ~ 14084493 (+)
AMCG00016264 NA coding upstream 214490 13976780 ~ 13980445 (+)
AMCG00016261 NA coding upstream 240643 13949907 ~ 13954292 (+)
AMCG00016273 dscr3 coding downstream 27254 14223888 ~ 14233628 (+)
AMCG00016272 NA coding downstream 61975 14258609 ~ 14264073 (+)
AMCG00016271 NA coding downstream 73683 14270317 ~ 14282590 (+)
AMCG00016279 hlcs coding downstream 99728 14296362 ~ 14298779 (+)
AMCG00016278 NA coding downstream 152338 14348972 ~ 14383679 (+)
G12487 NA non-coding upstream 10249 14182605 ~ 14184686 (+)
G12406 NA non-coding upstream 364048 13829734 ~ 13830887 (+)
G12368 NA non-coding upstream 535276 13657393 ~ 13659659 (+)
G12347 NA non-coding upstream 555347 13638302 ~ 13639588 (+)
G12331 NA non-coding upstream 643077 13551594 ~ 13551858 (+)
G12549 NA non-coding downstream 187271 14383905 ~ 14384657 (+)
G12566 NA non-coding downstream 200615 14397249 ~ 14398414 (+)
G12589 NA non-coding downstream 252178 14448812 ~ 14449212 (+)
G12591 NA non-coding downstream 254876 14451510 ~ 14451754 (+)
G12605 NA non-coding downstream 379953 14576587 ~ 14615709 (+)
G12351 NA other upstream 557934 13635442 ~ 13637001 (+)
G12349 NA other upstream 563138 13631285 ~ 13631797 (+)
G12348 NA other upstream 567224 13621879 ~ 13627711 (+)
AMCG00016241 NA other upstream 805299 13271584 ~ 13389636 (+)
AMCG00016221 NA other upstream 1408036 12778224 ~ 12786899 (+)
G12587 NA other downstream 241137 14437771 ~ 14438606 (+)
AMCG00016288 NA other downstream 548682 14745316 ~ 14783535 (+)
AMCG00016329 NA other downstream 2287721 16484355 ~ 16486003 (+)
G13012 NA other downstream 2920159 17116793 ~ 17121932 (+)
AMCG00016379 cwf19l2,LOC107560834,LOC107670086,LOC107728743,LOC107566889,LOC107669872 other downstream 3365784 17562418 ~ 17599581 (+)

Expression


Co-expression Network