AMCG00020608 (sntb2,LOC106573669,LOC106560900)


Basic Information

Item Value
gene id AMCG00020608
gene name sntb2,LOC106573669,LOC106560900
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 25810166 ~ 25811675 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020608
ATGTTTTCCATAGTGAAGTACATCAAAGAGGTCACCCCACTCTTTAAGAAGCCCTCGCTGGTGGCGGACCTGCCCTGGGATGGGGTGCGGCCCCAGTCCCCCAACCTGAGCGGCAGCGAGGACTCTGGCTCCCCCAAACACTCCGTCAACGCCAAGGACAAGAAGGTCATCCCCCTGAAGATGGGCTTCATCAGCCGCAACCTCACCATGCCAGACCTGGAGAACAGGTACCCCCACTCCTCACCCACACAGAACCGGTGCTCTATAAATCGCTTTGTCCGTAAGTAA

Function

symbol description
sntb2 Predicted to enable structural molecule activity. Predicted to be located in cytoplasm; cytoskeleton; and membrane. Predicted to be part of dystrophin-associated glycoprotein complex. Predicted to be active in synapse. Orthologous to human SNTB2 (syntrophin beta 2).

NR:

description
PREDICTED: beta-2-syntrophin

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020608 True 288 mRNA 0.57 2 25810166 25811675

Neighbor

gene id symbol gene type direction distance location
AMCG00020609 snta1,LOC107560074,LOC107728410,LOC107667670,LOC107744389 coding upstream 26918 25782048 ~ 25783248 (+)
AMCG00020598 znf276,zgc:158366 coding upstream 122990 25681616 ~ 25687176 (+)
AMCG00020599 NA coding upstream 199776 25601120 ~ 25610390 (+)
AMCG00020600 cdk10 coding upstream 221415 25579705 ~ 25588751 (+)
AMCG00020596 NA coding upstream 277803 25531176 ~ 25532363 (+)
AMCG00020606 sntb2 coding downstream 28029 25839704 ~ 25854564 (+)
AMCG00020607 vps4a,LOC106939979 coding downstream 43413 25855088 ~ 25861732 (+)
AMCG00020616 NA coding downstream 65580 25877255 ~ 25885079 (+)
AMCG00020611 NA coding downstream 108964 25920639 ~ 25932142 (+)
AMCG00020610 cotl1,LOC107684658,LOC107587015,LOC107559813,LOC107722478,LOC107738394 coding downstream 160858 25972533 ~ 25989687 (+)
G64406 NA non-coding upstream 81832 25721933 ~ 25728334 (+)
G64394 NA non-coding upstream 166792 25640593 ~ 25643374 (+)
G64378 NA non-coding upstream 238404 25569390 ~ 25571762 (+)
G64362 NA non-coding upstream 274119 25535753 ~ 25536047 (+)
G64300 NA non-coding upstream 476484 25332259 ~ 25333682 (+)
G64436 NA non-coding downstream 7716 25819391 ~ 25819782 (+)
G64457 NA non-coding downstream 82475 25894150 ~ 25895525 (+)
G64478 NA non-coding downstream 123230 25934905 ~ 25940113 (+)
G64555 NA non-coding downstream 383538 26195213 ~ 26197405 (+)
G64556 NA non-coding downstream 389389 26201064 ~ 26202040 (+)
AMCG00020603 NA other upstream 31184 25762135 ~ 25778982 (+)
G64372 NA other upstream 256846 25550911 ~ 25553320 (+)
AMCG00020585 NA other upstream 337280 25459096 ~ 25472886 (+)
AMCG00020573 NA other upstream 725293 25078142 ~ 25084873 (+)
AMCG00020572 NA other upstream 733476 25062373 ~ 25076690 (+)
AMCG00020621 LOC105904655 other downstream 243612 26055287 ~ 26096957 (+)
G64730 hsbp1,LOC102784925,LOC102222837,LOC103023435 other downstream 1604321 27415996 ~ 27418520 (+)
G64887 NA other downstream 3061955 28873630 ~ 28874072 (+)
G64908 NA other downstream 3196988 29008663 ~ 29009601 (+)
G64979 NA other downstream 3652889 29464564 ~ 29465712 (+)

Expression


Co-expression Network