G78226 (slc6a11,LOC107746711,LOC107686974,LOC107561801,LOC107697565,LOC107750026)


Basic Information

Item Value
gene id G78226
gene name slc6a11,LOC107746711,LOC107686974,LOC107561801,LOC107697565,LOC107750026
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056709.1
NCBI id CM032078.1
chromosome length 24513629
location 722464 ~ 723564 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU115761
AGAAAATGGCCCAAGCTAATATAACCACATAATAAACATTCAGGTGGGCTTCAATGACTTGGGTCGCATAGCCGATGCCTATAAGAGAACCTTCAAAGAGCGGGCAGACTTTTCGCCAACATGTGATGCCTCCTTCACTAGTGAACTGACCTAGCGCTGTTTCCAAGAAGAAGACAGGGATTCCACAGCAGACGAAGAAGATGACATAAGGCACAAAGAAAGCCACCTCCGCCGTTCTTGTAACACAGATATGGGAACCTCCAAACGTTGCCAAGGCCGATAATCTCTCCAGCCACTGACAACACAAACTCAACCTTATTATTCCACTGTCCCCTCTCATTCACCACCTTCTTGTCGTTGCTGCGCACTGCGCTCGGGCTCGCCGCTTCGGGGTCCATCGAATCGTCCGCTTTTCCATTTATGATGGGAATCGTCTTTTCGGCTGTCATGACGTCCTACAGCCTGAAACACACGGATTACAC

Function

symbol description
slc6a11 Enables monocarboxylic acid transmembrane transporter activity. Involved in monocarboxylic acid transport. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be active in GABA-ergic synapse and neuron projection. Predicted to be integral component of postsynaptic membrane and integral component of presynaptic membrane.

NR:

description
PREDICTED: sodium- and chloride-dependent GABA transporter 3-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU115761 True 482 lncRNA 0.49 3 722464 723564

Neighbor

gene id symbol gene type direction distance location
mettl1 mettl1,mettl1-b coding downstream 296799 414402 ~ 425665 (-)
LOC122353667 cyp27b1,LOC107747831,LOC107561793,LOC107684010 coding downstream 309879 406021 ~ 412585 (-)
si:ch1073-456m8.1 NA coding downstream 328278 386034 ~ 394186 (-)
avil avil,LOC107567939,LOC107684013,LOC107711597,LOC107698837,LOC107574443 coding downstream 337140 374160 ~ 385324 (-)
tegt tegt,LOC107574446,LOC107567938,LOC107684007,LOC107713865,LOC107711598,LOC107698838 coding downstream 349992 367846 ~ 372472 (-)
vgll4b vgll4,vgll4b,LOC107750033,LOC107697562,LOC107570332 coding upstream 188111 911675 ~ 933876 (-)
tamm41 tamm41 coding upstream 210288 933852 ~ 939272 (-)
LOC122353727 NA coding upstream 254033 977597 ~ 980116 (-)
LOC122353725 timp4,LOC107571219,LOC107667868,LOC107564284,LOC107687318,LOC107742036 coding upstream 261779 985343 ~ 990262 (-)
mkrn2os.2 LOC107758069,LOC107687314,LOC107564281 coding upstream 316803 1040367 ~ 1043419 (-)
LOC122353904 NA non-coding downstream 833 719275 ~ 721631 (-)
G78192 NA non-coding downstream 127823 592615 ~ 594641 (-)
G78167 dusp7,LOC107561798,LOC107677944,LOC107697567,LOC107712495 non-coding downstream 215823 458293 ~ 506641 (-)
G78164 NA non-coding downstream 283804 431687 ~ 438660 (-)
G78162 NA non-coding downstream 291042 430994 ~ 431422 (-)
G78298 NA non-coding upstream 182243 905807 ~ 907574 (-)
G78324 pparg non-coding upstream 297912 1021476 ~ 1023810 (-)
G78327 mkrn2,LOC107675967,LOC107571211,LOC107571213,LOC107742032 non-coding upstream 325842 1049406 ~ 1049936 (-)
G78331 NA non-coding upstream 326514 1050078 ~ 1052544 (-)
G78338 NA non-coding upstream 348982 1072546 ~ 1074456 (-)
G78170 NA other downstream 266466 453134 ~ 455998 (-)
G78144 alas1 other downstream 273563 443885 ~ 448901 (-)
LOC122353669 mettl21b,LOC107684011 other downstream 317053 402940 ~ 405411 (-)
LOC122354324 arfgap1 other downstream 393425 322213 ~ 329039 (-)
LOC122353949 prph,LOC107683634,LOC107730884,LOC107696041,LOC107737370 other downstream 433518 282263 ~ 288946 (-)
LOC122353728 NA other upstream 249390 972954 ~ 974787 (-)
phactr3b phactr3b,LOC107730624,LOC107670936,LOC107722000,LOC107654794,LOC107550338,LOC103365918,LOC106955159,LOC104947949 other upstream 493655 1217219 ~ 1260090 (-)
LOC122354408 LOC107683642,LOC107737350,LOC107572058 other upstream 865140 1588704 ~ 1696787 (-)
nab2 nab2,LOC107557549,LOC107730902,LOC107696037,LOC107683651,LOC107737369 other upstream 981060 1704624 ~ 1716129 (-)
LOC122354491 gata2a,gata2,LOC107680419,LOC107744843,LOC107573143 other upstream 2089788 2813352 ~ 2816128 (-)

Expression


Co-expression Network