G20295 (plcd3,plcd3a,LOC107674588,LOC107581738,LOC107654535,LOC107591554,LOC108432051)


Basic Information

Item Value
gene id G20295
gene name plcd3,plcd3a,LOC107674588,LOC107581738,LOC107654535,LOC107591554,LOC108432051
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 15168338 ~ 15169258 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU30221
CGTGCATACTGTTCGTTCAGGTCAATGTTGATCAGCTGTAGCAGATGTTTCACCTCGTCGTAGCTCATCTTCCCATCCTGGTTCTGATCCGCACGTCTCAGATAGCCTCGAATCCAATGGTCCAGCTTTTCTTTCTGGCTCATGTTGGAGACGCGGTCTTTGAGAATGCGGAGGCCTCGAACCCAGCCCTCCGCTTCGTCCTGTGTGGAGCAGCACAGATCCAGGCTCTTCCTTGCTCCGCGAAAGACCACAGTGAAGCAGTGTGTCTCTGGGACCAGACCAGCCATTCGTCGCAGACACTCCGACTGGCAGCCCTCCCGCACACACTCCACCTCCGTCACGC

Function

symbol description
plcd3a Predicted to enable phosphatidylinositol phospholipase C activity. Predicted to be involved in phosphatidylinositol-mediated signaling. Predicted to act upstream of or within intracellular signal transduction and lipid catabolic process. Predicted to be located in cleavage furrow and cytoplasm. Is expressed in spinal cord. Orthologous to human PLCD3 (phospholipase C delta 3).
plcd3 Predicted to enable phosphatidylinositol phospholipase C activity. Predicted to be involved in phosphatidylinositol-mediated signaling. Predicted to act upstream of or within angiogenesis; labyrinthine layer blood vessel development; and regulation of cell population proliferation. Predicted to be located in plasma membrane.

NR:

description
PREDICTED: 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase delta-3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU30221 True 343 TUCP 0.57 2 15168338 15169258

Neighbor

gene id symbol gene type direction distance location
tmem98 tmem98,LOC107674611,LOC107720031,LOC107738157,LOC107654470 coding upstream 69241 15092956 ~ 15099097 (+)
kcnj19a si:dkey-106c17.3,LOC107654469,LOC107581800,LOC107737881,LOC107674737,LOC107720030,LOC108432058 coding upstream 117901 15029823 ~ 15050437 (+)
asic2 asic2,LOC107654528,LOC107674665,LOC107720021,LOC108411330,LOC107592342 coding upstream 210612 14684646 ~ 14957726 (+)
hrob LOC107721529,LOC107654526,LOC107601306,LOC107720097 coding upstream 489473 14672317 ~ 14678865 (+)
LOC122342191 NA coding upstream 497658 14670596 ~ 14670680 (+)
zgc:100868 LOC107654462,LOC107738142,LOC107581796 coding downstream 81276 15250534 ~ 15257035 (+)
aldoaa aldoaa,aldoab,LOC107720037,LOC107674678,LOC107581735,LOC107689930 coding downstream 111470 15280728 ~ 15285025 (+)
cln3 cln3,LOC107591583,LOC107737814,LOC107720039,LOC107674677,LOC107654539,LOC107581771 coding downstream 118350 15287608 ~ 15292909 (+)
prpsap2 prpsap2,LOC107737786,LOC107581734,LOC107654541,LOC103393631 coding downstream 124120 15293378 ~ 15300967 (+)
epn2 epn2,LOC107654543,LOC107674690,LOC107720043,LOC107591621 coding downstream 150624 15319882 ~ 15338761 (+)
G20269 NA non-coding upstream 29438 15129681 ~ 15138900 (+)
G20188 NA non-coding upstream 175301 14990229 ~ 14993037 (+)
G20179 NA non-coding upstream 178346 14972299 ~ 14989992 (+)
G20183 NA non-coding upstream 196677 14971012 ~ 14971661 (+)
G20180 NA non-coding upstream 199053 14920245 ~ 14969285 (+)
G20415 NA non-coding downstream 417954 15587212 ~ 15588809 (+)
LOC122334397 NA non-coding downstream 545474 15714732 ~ 15727870 (+)
LOC122334400 NA non-coding downstream 550989 15720247 ~ 15721303 (+)
G20452 LOC107674632,LOC107720067,LOC107591813,LOC107748300 non-coding downstream 692755 15862013 ~ 15864962 (+)
G20465 NA non-coding downstream 703544 15872802 ~ 15873925 (+)
G20172 rps11,LOC107674708 other upstream 496770 14664919 ~ 14671568 (+)
G20167 NA other upstream 545480 14618994 ~ 14622858 (+)
G20148 LOC107721478,LOC107654521,LOC107674594 other upstream 552930 14535179 ~ 14615408 (+)
abcc1 abcc1,LOC107721490,LOC107654509,LOC107720005,LOC107688147,LOC107601224,LOC107590430 other upstream 895029 14255490 ~ 14273309 (+)
smim22 si:ch1073-443f11.2,smim22,LOC107688153,LOC107721520,LOC107601279 other upstream 1045210 14120185 ~ 14123128 (+)
zgc:165423 LOC107738133,LOC107654537,LOC107581795 other downstream 100542 15269800 ~ 15280113 (+)
fscn1a fscn1a,LOC107703419,LOC107742378,LOC107581720,LOC107674660,LOC107720060 other downstream 537678 15706936 ~ 15744194 (+)
gna12a gna12,gna12a,LOC107703403,LOC107753491,LOC107674729,LOC107758336 other downstream 1010362 16179620 ~ 16207846 (+)
LOC122331507 psmg3,LOC107703392 other downstream 1521445 16690703 ~ 16699482 (+)
micall2a micall2,micall2a,LOC107703317,LOC107745593,LOC107568921,LOC107674716 other downstream 1601287 16770545 ~ 16784811 (+)

Expression


Co-expression Network