CI01000004_04177460_04183900 (PBX1A, PBX1B, PBX1)


Basic Information

Item Value
gene id CI01000004_04177460_04183900
gene name PBX1A, PBX1B, PBX1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 4177460 ~ 4183993 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000004_04177460_04183900.mRNA
AGCTCCTGTAGTTATGTTTACATGCACAGAGACTGATCCGTGTGCCACCCCACTGTGCATGTTCAGGCGTGTAATGAATTCACCACCCATGTGATGAACCTGCTGAGGGAGCAGTCTCGCACTCGGCCCATCTCCCCCAAAGAGATCGAGCGCATGGTGAGCATCATCCATCGCAAGTTCAGCTCCATCCAGATGCAGCTCAAACAGAGCACCTGCGAGGCGGTCATGATCCTGCGCTCCCGCTTCCTCGACGCCAGACGAAAAAGGAGAAACTTCAATAAGCAGGCCACAGAGATCCTGAACGAATACTTCTACTCCCACCTAAGCAACCCGTACCCCAGCGAGGAGGCCAAGGAGGAGCTGGCAAAGAAATGCTCCATTACAGTCTCACAAGTATCCAACTGGTTTGGAAATAAGAGAATCAGATACAAGAAAAATATTGGAAAATTCCAAGAAGAAGCCAACATGTACGCTGCCAGAACCGCCGCTAACGCAACCAACGTCTCCACCCACGGCAGCCAAGCCAACTCGCCTTCCACACCAAATTCAGCTGGTTCTGCCGGCTCTTTTAACATGAACTCTGGGGACTTGTTCATGAGTGTGCAGTCTCTGAATGGGGACTCATACCAGGGGGCCCAAGTGGGGGCCAACGTTCAGTCACAGGTGGATACTCTTCGCCATGTTATCAGTCAGACAGGCGGATACAGTGAAAGCCTCGCTGCCAGTCAGATATACAGTCCACAGGGCATCAAT

Function

symbol description
pbx1a Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within hemopoiesis; swim bladder morphogenesis; and vasculature development. Predicted to be located in nucleus. Is expressed in several structures, including central nervous system; head; pleuroperitoneal region; presumptive swim bladder; and swim bladder bud. Human ortholog(s) of this gene implicated in B-lymphoblastic leukemia/lymphoma. Orthologous to human PBX1 (PBX homeobox 1).
pbx1b Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in animal organ development; neuron development; and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Is expressed in head. Human ortholog(s) of this gene implicated in B-lymphoblastic leukemia/lymphoma. Orthologous to human PBX1 (PBX homeobox 1).
pbx1 Enables transcription cis-regulatory region binding activity. Contributes to RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in negative regulation of DNA-binding transcription factor activity. Located in cytoplasm and nucleoplasm. Part of RNA polymerase II transcription regulator complex. Implicated in B-lymphoblastic leukemia/lymphoma.

GO:

id name namespace
GO:0030325 adrenal gland development biological_process

KEGG:

id description
K09355 PBX1; pre-B-cell leukemia transcription factor 1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000004_04177460_04183900.mRNA True 753 mRNA 0.52 5 4177460 4183993

Neighbor

gene id symbol gene type direction distance location
CI01000004_04062573_04103207 NA coding downstream 74099 4061197 ~ 4103361 (-)
CI01000004_03802203_03806124 NA coding downstream 370289 3801136 ~ 3807171 (-)
CI01000004_03737431_03794978 PTPRFB, PTPRF coding downstream 382010 3737370 ~ 3795450 (-)
CI01000004_03705008_03734116 NA coding downstream 441966 3704143 ~ 3735494 (-)
CI01000004_03681226_03695729 KDM4AB, KDM4A coding downstream 480907 3681108 ~ 3696553 (-)
CI01000004_04241031_04243866 PBX1A coding upstream 56249 4240242 ~ 4244611 (-)
CI01000004_04267237_04294023 NA coding upstream 82733 4266726 ~ 4294110 (-)
CI01000004_04361874_04362518 NA coding upstream 177668 4361661 ~ 4362716 (-)
CI01000004_04375211_04379590 NA coding upstream 191117 4375110 ~ 4379590 (-)
CI01000004_04406215_04410740 CDC20 coding upstream 222222 4406215 ~ 4410740 (-)
G27443 NA non-coding downstream 8280 4168834 ~ 4169180 (-)
G27461 NA non-coding downstream 17883 4159296 ~ 4159577 (-)
G27458 NA non-coding downstream 21535 4155509 ~ 4155925 (-)
G27456 NA non-coding downstream 23081 4154152 ~ 4154379 (-)
G27425 NA non-coding downstream 77922 4099220 ~ 4099538 (-)
G27440 NA non-coding upstream 52401 4236394 ~ 4238592 (-)
G27438 NA non-coding upstream 81066 4265059 ~ 4318197 (-)
G27504 NA non-coding upstream 135242 4319235 ~ 4319490 (-)
G27505 NA non-coding upstream 139102 4323095 ~ 4323350 (-)
G27511 NA non-coding upstream 151113 4335106 ~ 4335436 (-)
G26788 NA other downstream 901739 3267683 ~ 3275721 (-)
CI01000004_01773383_01774888 INSL5B other downstream 2402519 1772928 ~ 1774942 (-)
G27746 NA other upstream 994234 5178227 ~ 5203724 (-)
CI01000004_05617072_05627369 NA other upstream 1436390 5616644 ~ 5628289 (-)
CI01000004_06539836_06541252 NA other upstream 2350834 6538904 ~ 6541252 (-)
G29388 NA other upstream 2447300 6631293 ~ 6631907 (-)
G29656 NA other upstream 3780371 7964364 ~ 7965500 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location