G55193


Basic Information

Item Value
gene id G55193
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056705.1
NCBI id CM032074.1
chromosome length 41700998
location 22089462 ~ 22090498 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU81768
GTGTATTACCGGCACAGAACATGTTATCGGTGATGATGACCGAGGTGGAATTTCGACAGATGGCCTGATCCACAATAGGCAAGTGAATCTGTTGAAGCACTGATGGAAGATTGGCTGGGTTTGAGGTCCACGATTCCCTGAGGTTTCCCCAGCCAGTCACACGGCCCTTGTAATCTGCAAACATCAAGTCTTTGCAATGTTTTTCGTGGGCAGACAAATAGGGTGGATCTCATTCGTAAAAACGACAGGCTTCTTCATGTGCAAAAGAGCAATGTCTCGGTTTAGGTTTTCCTTCCAGTTATATTTTGGGTGGACAATGATTTCATCAATGGCCACGATCTTCTCAGTGCCCCTCTCATACTGGTTCGAGAGTGTTTTCCAAGGCGGACGATGATATCATTGATCGTGAAGTTCTTGTTCCACGGTGGGTAGAGAATGCAGTGGGCGGCCGTGAGAATCCATTCATCACTGATCAGACTGGCTCCACACAGCAGCTCTTGGGGACTACGCTTATACAGCATCACCTGCCTGCGAATGAAAC

Function

GO:

id name namespace
GO:0048732 gland development biological_process
GO:0061008 hepaticobiliary system development biological_process
GO:0001889 liver development biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU81768 True 541 lncRNA 0.48 3 22089462 22090498

Neighbor

gene id symbol gene type direction distance location
fbxo3 fbxo3,LOC107677229,LOC107657087 coding downstream 25224 22056184 ~ 22064238 (-)
LOC122349297 cd59,LOC107560108,LOC107736732,LOC107677235,LOC107722399,LOC107554602 coding downstream 34082 22052797 ~ 22055380 (-)
aplnr2 aplnr2,LOC107657145,LOC107758451,LOC107554601,LOC107722398,LOC107677393,LOC107706925,LOC107560106 coding downstream 38822 22047902 ~ 22050640 (-)
c6ast1 NA coding downstream 51325 22030321 ~ 22038137 (-)
LOC122348456 LOC107657143,LOC107758450,LOC107554600,LOC107722401,LOC107560096,LOC107677258,LOC107758449 coding downstream 65861 22018507 ~ 22023601 (-)
atg13 atg13,LOC107677120,LOC107722374,LOC107703285,LOC107554630 coding upstream 15063 22105561 ~ 22114501 (-)
phf21aa LOC107722426,LOC107560114,LOC107656174,LOC107703284,LOC107742561,LOC107554634 coding upstream 31360 22121858 ~ 22141854 (-)
chrm4a chrm4a,chrm4,LOC107742565,LOC107722408,LOC107554636,LOC107560117 coding upstream 196829 22287327 ~ 22300473 (-)
ambra1a LOC107722385,LOC107656180,LOC107560119,LOC107703290 coding upstream 225273 22315771 ~ 22380504 (-)
snx1b snx1b,LOC107703294,LOC107560120,LOC107722395,LOC107656183,LOC107742568 coding upstream 298008 22388506 ~ 22395720 (-)
G55191 LOC107703282,LOC107742559,LOC107677184,LOC107554629,LOC107560109 non-coding downstream 710 22087346 ~ 22088752 (-)
G55194 NA non-coding downstream 2374 22086634 ~ 22087088 (-)
G55190 NA non-coding downstream 6169 22082964 ~ 22083293 (-)
G55189 NA non-coding downstream 6622 22082476 ~ 22082840 (-)
G55065 NA non-coding downstream 300069 21788750 ~ 21789393 (-)
G55196 NA non-coding upstream 7363 22097861 ~ 22099285 (-)
G55297 NA non-coding upstream 153738 22244236 ~ 22244656 (-)
G55318 NA non-coding upstream 192493 22282991 ~ 22284848 (-)
G55319 NA non-coding upstream 318773 22409271 ~ 22409826 (-)
G55338 NA non-coding upstream 396630 22487128 ~ 22540898 (-)
G55165 cd59,LOC107560108,LOC107736732,LOC107677235,LOC107722399,LOC107554602 other downstream 33217 22052796 ~ 22056245 (-)
cebpa cebpa,LOC107722391,LOC107696713,LOC107551484,LOC107733057,LOC107657126,LOC107580367 other downstream 336024 21653321 ~ 21753438 (-)
G54872 LOC107713054,LOC107550285,LOC107657115 other downstream 1021087 21064933 ~ 21068375 (-)
G54687 NA other downstream 1808656 20278852 ~ 20280806 (-)
G54637 rfx7,LOC107689974,LOC107740453,LOC107563480,LOC107664392,LOC107755110,LOC107553094 other downstream 2087816 19995062 ~ 20001646 (-)
si:dkey-23n7.10 si:dkey-23n7.10,LOC107560112,LOC107742582,LOC107554633,LOC107722376,LOC107703276 other upstream 12416 22102914 ~ 22105329 (-)
LOC122347949 LOC107560124,LOC107722378,LOC107656186,LOC107554594,LOC107742573 other upstream 341902 22432400 ~ 22440439 (-)
otog LOC107722353,LOC107656169,LOC107591037,LOC107703275,LOC107742581,LOC107554595 other upstream 353300 22443798 ~ 22488923 (-)
wdr97 LOC107722359,LOC107591040,LOC107684931 other upstream 679134 22769632 ~ 22779326 (-)
nom1 nom1,LOC107724412,LOC107684778,LOC107653288,LOC107742133 other upstream 960692 23051190 ~ 23058781 (-)

Expression


Co-expression Network