G30864


Basic Information

Item Value
gene id G30864
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10755252 ~ 10755575 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU34911
CAGCAGCAGTCCAGTCCTTTTTGTCTTAAGCCCAGGCGAGACACTTCTGACGCTGTCTGTTGTTCAAGAGTGGCTTGACACAAGGAATGCGACAGCTGAAACCCATGTCTTGCATACGTCTGTGCGTAGTGGTTCTTGAAGCACTGACTCCAGCTGCAGTCCACTCTTTGTAAATCTCCCCCACATTTTTGAATGGGTTTTGTTTCACAATCCTCTCCAGGGTGCAGTTATCGCTATTGCTTGTACACTTTTTTCTACCACATCTTTTCCTTCCCTTCGCCTCTCTATTAATGTGCTTGGACACAGAGCTCTGTGAACAGCCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU34911 True 324 lncRNA 0.48 1 10755252 10755575

Neighbor

gene id symbol gene type direction distance location
CI01000004_10736615_10738593 RDH10, RDH10B coding upstream 16226 10736615 ~ 10739026 (+)
CI01000004_10712377_10730563 KCNB2 coding upstream 24689 10712377 ~ 10730563 (+)
CI01000004_10683400_10692323 NA coding upstream 62687 10683400 ~ 10692565 (+)
CI01000004_10630265_10647904 NA coding upstream 107348 10630265 ~ 10647904 (+)
CI01000004_10610634_10613290 ENG2B coding upstream 141622 10609780 ~ 10613630 (+)
CI01000004_10767883_10769627 TMEM70 coding downstream 12308 10767883 ~ 10769753 (+)
CI01000004_10827227_10829982 PI15B, PI15 coding downstream 71387 10826962 ~ 10831024 (+)
CI01000004_10835420_10847343 CRISPLD1B coding downstream 79845 10835420 ~ 10847343 (+)
CI01000004_10867891_10869483 SOCS6B coding downstream 112085 10867660 ~ 10870925 (+)
CI01000004_10888481_10897508 NETO1 coding downstream 132906 10888481 ~ 10897698 (+)
G30863 NA non-coding upstream 946 10753957 ~ 10754306 (+)
G30861 NA non-coding upstream 3957 10750834 ~ 10751295 (+)
G30678 NA non-coding upstream 19129 10732387 ~ 10736123 (+)
G30839 NA non-coding upstream 53816 10701224 ~ 10701436 (+)
G30689 NA non-coding upstream 58045 10693917 ~ 10697207 (+)
G30870 NA non-coding downstream 6239 10761814 ~ 10763042 (+)
G30872 NA non-coding downstream 21728 10777303 ~ 10777535 (+)
G30889 NA non-coding downstream 58748 10814323 ~ 10814709 (+)
G30891 NA non-coding downstream 61339 10816914 ~ 10817179 (+)
G30894 NA non-coding downstream 66576 10822151 ~ 10822374 (+)
G30797 NA other upstream 257464 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 1774268 8976254 ~ 8980984 (+)
G28859 NA other upstream 2155649 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 2304025 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 3098869 7654234 ~ 7656383 (+)
G31710 NA other downstream 881676 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 909198 11666900 ~ 11667659 (+)
G31865 NA other downstream 1436555 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 1887179 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 3267972 14035393 ~ 14039142 (+)

Expression


Co-expression Network