G33919


Basic Information

Item Value
gene id G33919
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 14758132 ~ 14792115 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38444
CTGTTCCCACAATGAGAATAAGTATGAAGCATGTGTCCATGTTGAATCAGATCAGATCAGTTCTCTGTTGAGGCTCTCAGTGCTTGAGCTGTAAGTCACTGCAGATCAGTCACAAACACACACAGGAACTTCCTGCTTTATAAAGGCATGGCTTAAATACTAGATGTCATTTTTCAGTCTGTCTAATTTCCTCTCATTTCTCATGAACATGAAAATATTAACAGAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38444 True 226 lncRNA 0.41 2 14758132 14792115

Neighbor

gene id symbol gene type direction distance location
CI01000004_14507781_14513019 NA coding upstream 244688 14506560 ~ 14513444 (+)
CI01000004_14498216_14504721 NA coding upstream 252977 14498054 ~ 14505155 (+)
CI01000004_14448323_14458776 NA coding upstream 298951 14446505 ~ 14459181 (+)
CI01000004_14412728_14424282 SMG7 coding upstream 333266 14412728 ~ 14424866 (+)
CI01000004_14371097_14380914 NA coding upstream 377218 14370061 ~ 14380914 (+)
CI01000004_14864427_14865483 ING5B, ING5, ING5.L coding downstream 71983 14864098 ~ 14865753 (+)
CI01000004_14877615_14885956 PAK2A, PAK2 coding downstream 85345 14877460 ~ 14886499 (+)
CI01000004_14889786_14894594 KLHL6 coding downstream 97671 14889786 ~ 14894922 (+)
CI01000004_14910312_14915166 NA coding downstream 117999 14910114 ~ 14915979 (+)
CI01000004_14919607_14929407 GOLIM4B coding downstream 127360 14919475 ~ 14929407 (+)
G33662 NA non-coding upstream 222788 14535078 ~ 14535344 (+)
G33644 NA non-coding upstream 229351 14528530 ~ 14528781 (+)
G33096 NA non-coding upstream 284230 14463206 ~ 14473902 (+)
G33108 NA non-coding upstream 326898 14430991 ~ 14431234 (+)
G33181 NA non-coding upstream 391685 14366239 ~ 14366447 (+)
G33951 NA non-coding downstream 53230 14845345 ~ 14853442 (+)
G34004 NA non-coding downstream 243902 15036017 ~ 15036233 (+)
G34009 NA non-coding downstream 253127 15045242 ~ 15045445 (+)
G34017 NA non-coding downstream 301990 15094105 ~ 15094375 (+)
G34027 NA non-coding downstream 311235 15103350 ~ 15103577 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 721232 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 2102421 12646838 ~ 12652570 (+)
G31865 NA other upstream 2562985 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 3090473 11666900 ~ 11667659 (+)
G31710 NA other upstream 3115732 11637251 ~ 11642400 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 299129 15091200 ~ 15097173 (+)
G34220 NA other downstream 1147242 15939357 ~ 15939950 (+)
G33815 NA other downstream 1271300 16063415 ~ 16066464 (+)
G34400 NA other downstream 2185213 16971995 ~ 17025976 (+)

Expression


Co-expression Network