G41128


Basic Information

Item Value
gene id G41128
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 1420533 ~ 1499033 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU46696
CCCAAATTCAGTATCTCAGAAAATTAGAATATTACTTAAGACCAATACAAAGAAAGGATTTTTGTCCAACTGAAAAGTATGAACATGAAAAGTATGAGCATGTACAGCACTCAATACTTAGTTGGGGCTCCTTTTGCCTGAATTACTGCAGCAATGCGGTGTGGCATGGAGTCGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU46696 True 175 lncRNA 0.38 2 1420533 1499033

Neighbor

gene id symbol gene type direction distance location
CI01000006_01158519_01160763 NA coding upstream 259527 1157729 ~ 1161006 (+)
CI01000006_01149220_01154850 MAT2B coding upstream 265219 1149041 ~ 1155314 (+)
CI01000006_01139490_01142592 NA coding upstream 277708 1138955 ~ 1142825 (+)
CI01000006_01032572_01040625 CLK4B coding upstream 379391 1032572 ~ 1041142 (+)
CI01000006_01006114_01006327 NA coding upstream 413939 1006114 ~ 1006594 (+)
CI01000006_01525438_01530330 NA coding downstream 26405 1525438 ~ 1530375 (+)
CI01000006_01545476_01546708 CRCP coding downstream 46443 1545476 ~ 1546718 (+)
CI01000006_01551365_01552945 NA coding downstream 52332 1551365 ~ 1553658 (+)
CI01000006_01554462_01567732 TPST1L, TPST1 coding downstream 55429 1554462 ~ 1567772 (+)
CI01000006_01570716_01587422 NA coding downstream 71683 1570716 ~ 1587781 (+)
G41087 NA non-coding upstream 35020 1298166 ~ 1385513 (+)
G41081 NA non-coding upstream 129028 1290577 ~ 1291505 (+)
G41056 NA non-coding upstream 166838 1250405 ~ 1253695 (+)
G41045 NA non-coding upstream 196669 1222090 ~ 1223864 (+)
G41028 NA non-coding upstream 234790 1184065 ~ 1185743 (+)
G41165 NA non-coding downstream 879 1499912 ~ 1500164 (+)
G41225 NA non-coding downstream 339109 1838142 ~ 1839882 (+)
CI01000006_01842317_01859671 NA non-coding downstream 361271 1842317 ~ 1861834 (+)
G41262 NA non-coding downstream 417601 1916634 ~ 1916911 (+)
G41263 NA non-coding downstream 419372 1918405 ~ 1918737 (+)
G40768 NA other upstream 927507 488407 ~ 493026 (+)
G40767 NA other upstream 937198 360009 ~ 484185 (+)
G40772 NA other upstream 941339 475465 ~ 479194 (+)
G41170 NA other downstream 193032 1692065 ~ 1695821 (+)
G41424 NA other downstream 1146629 2645662 ~ 2660570 (+)
G41591 NA other downstream 1337134 2836167 ~ 2839421 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other downstream 2230197 3734554 ~ 3736035 (+)
G41996 NA other downstream 3618173 5117206 ~ 5124149 (+)

Expression


Co-expression Network