G45356


Basic Information

Item Value
gene id G45356
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 8154796 ~ 8157535 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU51563
GGTTTTAAAAGGCAGCTTTAAATGAATAGGACAAAACCTCACCTGAGCACAACGGCCAACACCACCATTGTAACGACGGAAGGGAACACACTGGTGCTTGACCATCACATCCTTCAGGTACTTGTTAGCCTTGCGGATGTGCATGCCTTTGATGGCCTGGGCGGTCTCACGGGTGTTCTTGAAGTGAACACGAAGGTTTGAACCCCTCGACTTGCATGATTTAGTCGGGTTCTCTGGGTCGAGAGAGTAGCGGACCATTTTCAGAGATGTTTCTCAGGCCGCGGAAGGGAAGAGGAAGTGAAAGGCATTCTGGGAGAACAAATCCGTTCTTACTTCTTCGTGGAACGTCTTCTGTAGCAACGAGCGCTTTGATAAAGTGCTAGCGCCGCCCAGTGGCTGCGCGACCAGTTATTTTTTAAATAAATAAGACATTTATTTTTTAATTATTAAAAAATAATACTTTTATAAATAATTTTTATCTATCAAAAATTTAAATAAACAATACAGTTGCAATACAGAATTTCTGCTGAACGTATGATATGAACATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU51563 True 548 lncRNA 0.44 4 8154796 8157535

Neighbor

gene id symbol gene type direction distance location
CI01000006_08108713_08122179 NA coding upstream 32432 8108563 ~ 8122364 (+)
CI01000006_08025159_08032131 NA coding upstream 122173 8025159 ~ 8032623 (+)
CI01000006_07939608_07940846 RXFP3 coding upstream 213381 7939318 ~ 7941415 (+)
CI01000006_07757777_07795187 NNT.L, NNT coding upstream 359538 7757526 ~ 7795258 (+)
CI01000006_07699736_07726659 MFHAS1 coding upstream 427799 7699736 ~ 7726997 (+)
CI01000006_08184916_08188512 NEFMA coding downstream 27264 8184799 ~ 8189299 (+)
CI01000006_08198328_08199463 NA coding downstream 40662 8197881 ~ 8200145 (+)
CI01000006_08222787_08225568 MED15 coding downstream 65252 8222787 ~ 8225568 (+)
CI01000006_08305571_08341681 NA coding downstream 148036 8305571 ~ 8341681 (+)
CI01000006_08366730_08400944 NA coding downstream 208555 8366090 ~ 8402325 (+)
G45381 NA non-coding upstream 8716 8133207 ~ 8146080 (+)
G45346 NA non-coding upstream 85552 8069032 ~ 8069244 (+)
G45313 NA non-coding upstream 146517 8007722 ~ 8008279 (+)
G45316 NA non-coding upstream 149244 8004311 ~ 8005552 (+)
G45325 NA non-coding upstream 160579 7993852 ~ 7994217 (+)
G45391 NA non-coding downstream 1101 8158636 ~ 8158893 (+)
G45392 NA non-coding downstream 1710 8159245 ~ 8159467 (+)
G45359 NA non-coding downstream 77203 8234738 ~ 8238406 (+)
G45438 NA non-coding downstream 175044 8332579 ~ 8333478 (+)
G45528 NA non-coding downstream 415159 8572694 ~ 8574744 (+)
G45336 NA other upstream 132845 8019342 ~ 8021951 (+)
G45265 NA other upstream 234441 7883867 ~ 7920355 (+)
G45178 NA other upstream 471125 7607604 ~ 7683671 (+)
G44872 NA other upstream 766912 7356352 ~ 7387884 (+)
CI01000006_07167131_07168925 NA other upstream 984262 7166778 ~ 7168925 (+)
G45355 NA other downstream 52020 8209555 ~ 8212388 (+)
G45416 NA other downstream 661279 8818814 ~ 8834697 (+)
G46652 NA other downstream 1999044 10156579 ~ 10159251 (+)
G47145 NA other downstream 2327823 10485358 ~ 10511806 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G1045790 LOC107722835 non-coding NC_048576.1 CM023230.2 19298094 ~ 19301068 (+)