G47148


Basic Information

Item Value
gene id G47148
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 10493349 ~ 10495939 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU53611
ATTAATGATGAACACCTGCTGTTAACAAGCAGAATCACTGAAGAAAAGAGAAACGCAAGAACTACAACTGACTTCAGCCAAAACCATTTAATTGAAATCAACTGAAGATAAAAGTCATTAAATCTCACTAGATCTGATTAAAAGATCTGATTCACTTATTACTAACCAGATTGACTTTATTTCTGTCACAAGTCTAAAGAAGTTCTTATTGAGAATTAACAGAGGTTTAGATGTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU53611 True 236 lncRNA 0.45 2 10493349 10495939

Neighbor

gene id symbol gene type direction distance location
CI01000006_10363884_10364804 NA coding upstream 127778 10363796 ~ 10365571 (+)
CI01000006_10177090_10192651 NA coding upstream 299830 10177090 ~ 10193519 (+)
CI01000006_09998680_10008491 LHX5 coding upstream 484301 9998680 ~ 10009048 (+)
CI01000006_09918611_09921465 MZT2B coding upstream 571556 9918611 ~ 9921793 (+)
CI01000006_09910027_09913958 NA coding upstream 579245 9909370 ~ 9914104 (+)
CI01000006_10518326_10566504 SFSWAP coding downstream 22387 10518326 ~ 10566504 (+)
CI01000006_10574971_10578629 NA coding downstream 78669 10574608 ~ 10578964 (+)
CI01000006_10593624_10605226 NA coding downstream 97305 10593244 ~ 10606273 (+)
CI01000006_10707037_10743311 MMP17, MMP17A coding downstream 211005 10706944 ~ 10743594 (+)
CI01000006_10747943_10768998 ULK1B coding downstream 252004 10747943 ~ 10769038 (+)
G47140 NA non-coding upstream 10184 10462462 ~ 10483165 (+)
G47106 NA non-coding upstream 12106 10403274 ~ 10481243 (+)
G47108 NA non-coding upstream 30925 10408876 ~ 10462424 (+)
G47102 NA non-coding upstream 132982 10343313 ~ 10360367 (+)
G47079 NA non-coding upstream 189163 10303952 ~ 10304186 (+)
G47109 NA non-coding downstream 12011 10507950 ~ 10508752 (+)
G47217 NA non-coding downstream 21772 10517711 ~ 10517922 (+)
G47218 NA non-coding downstream 70715 10566654 ~ 10567299 (+)
G47220 NA non-coding downstream 119386 10615325 ~ 10616018 (+)
G47213 NA non-coding downstream 169027 10664966 ~ 10672592 (+)
G46652 NA other upstream 334098 10156579 ~ 10159251 (+)
G45416 NA other upstream 1658652 8818814 ~ 8834697 (+)
G45355 NA other upstream 2280961 8209555 ~ 8212388 (+)
CI01000006_08198328_08199463 NA other upstream 2293204 8197881 ~ 8200145 (+)
G45336 NA other upstream 2471398 8019342 ~ 8021951 (+)
G47159 NA other downstream 920290 11416229 ~ 11521703 (+)
G47318 NA other downstream 1128328 11624267 ~ 11638252 (+)
G48094 NA other downstream 1781681 12277620 ~ 12279541 (+)
G48081 NA other downstream 1881067 12377006 ~ 12384827 (+)

Expression


Co-expression Network