G86027 (kif13b,kif13ba,LOC108437739)


Basic Information

Item Value
gene id G86027
gene name kif13b,kif13ba,LOC108437739
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035905.1
NCBI id CM008308.1
chromosome length 42966623
location 35853638 ~ 35857108 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU115818
CTCCATCATAATGTTTAACGATCTGCAGGTCAAAGAACTCGTCTTCATCCTCCCCACTCAGAGAGGCATCCCACCCACCGGCTTCAGGGGTTTCTAGGTTTTCCTGTGAGCTGAAATCATCCGCACTCAGATCAAGGAAGAGGACAGGAATGTGAGTTTCCATCCCAGGCACCGGTACCCACTCTGCAGGAGCTCCTGGAATGCCACTACCAGCAGAGGGCACCATCACTGCATTCCTCTCCTCTGTCAGAGTCAGACGACACTCCAGCAGCTGAGCCTCCCTCTCCACATCATCCTCCGATTTATCTGTTTTGCTGACCAGGGTCTGTAGATGTTCATCCAGGTACTCCTGTCTTTTAGTGAGTGCAGCCAGCCACTGTCGCCGCAGTCGCTCCAGATCCCGCTCCTGATAGCTGTCCATTTCATCCCCTTCCGGCTCCTGAGAGTCATTGGCTTTAGCTGGGCGAGCCTGTCTGATC

Function

symbol description
kif13ba Predicted to enable ATP hydrolysis activity; microtubule binding activity; and microtubule motor activity. Predicted to be involved in microtubule-based movement. Predicted to be part of kinesin complex. Predicted to be active in microtubule. Orthologous to human KIF13B (kinesin family member 13B).
kif13b Enables 14-3-3 protein binding activity and protein kinase binding activity. Involved in regulation of axonogenesis. Located in axon and cytoplasm.

NR:

description
PREDICTED: kinesin-like protein KIF13B

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU115818 True 479 lncRNA 0.54 6 35853638 35857108

Neighbor

gene id symbol gene type direction distance location
LOC103031708 LOC103031708 coding downstream 135426 35694549 ~ 35718212 (-)
LOC103042065 LOC108437746 coding downstream 220883 35607086 ~ 35632755 (-)
scaf8 scaf8,LOC107749595,LOC107675315 coding downstream 253351 35557208 ~ 35600287 (-)
tiam2 tiam2 coding downstream 342893 35348184 ~ 35510745 (-)
cldn20 cldn20,LOC101886267,LOC107571061,LOC107675320,LOC107573130,LOC108443299,LOC107728965 coding downstream 516176 35321469 ~ 35337462 (-)
LOC103039887 LOC108437743 coding upstream 33969 35891077 ~ 35911845 (-)
kcnk13 kcnk13,LOC107680770,LOC107588297,LOC107751801,LOC107755770,LOC107693081 coding upstream 64373 35921481 ~ 35934896 (-)
tdp1 tdp1 coding upstream 112529 35969637 ~ 36045110 (-)
adck1 adck1,LOC107740534,LOC107680795,LOC107751735,LOC107676278 coding upstream 1287389 37144497 ~ 37395219 (-)
slirp slirp coding upstream 1543480 37400588 ~ 37403021 (-)
G86026 LOC108437739,LOC107680773,LOC107751739,LOC107588271,LOC107693111 non-coding downstream 91 35851774 ~ 35853547 (-)
G86024 kif13b,LOC108437739,LOC107751739,LOC107583481 non-coding downstream 9991 35839946 ~ 35843647 (-)
G86018 NA non-coding downstream 82188 35770977 ~ 35771450 (-)
G86017 NA non-coding downstream 101961 35750558 ~ 35751677 (-)
G86016 NA non-coding downstream 103405 35749864 ~ 35750233 (-)
G86022 NA non-coding upstream 22292 35879400 ~ 35887714 (-)
G86032 NA non-coding upstream 45961 35903069 ~ 35903473 (-)
G86121 NA non-coding upstream 305424 36162532 ~ 36164252 (-)
G86203 NA non-coding upstream 545404 36402512 ~ 36402721 (-)
G86205 ston2 non-coding upstream 577602 36434710 ~ 36454220 (-)
G85902 tfb1m other downstream 558604 35288232 ~ 35295034 (-)
daam2 daam2 other downstream 1382033 34274391 ~ 34471605 (-)
rbks rbks,LOC107553733,LOC107656748 other downstream 1841076 33955195 ~ 34012562 (-)
G85618 slc4a1ap other downstream 2014009 33834012 ~ 33839629 (-)
G85550 NA other downstream 2334967 33509680 ~ 33518671 (-)
nrxn3 nrxn3,LOC107755774,LOC107583487 other upstream 731796 36588904 ~ 37101581 (-)
G86432 NA other upstream 2125766 37982874 ~ 38069052 (-)
dicer1 dicer1,LOC107552827,LOC107671118,LOC107668604 other upstream 3951022 39808130 ~ 39858569 (-)
LOC111193261 NA other upstream 4676260 40533368 ~ 40536334 (-)
LOC103044865 NA other upstream 4905564 40762672 ~ 40770501 (-)

Expression


Co-expression Network