CI01000009_07490344_07493862 (ESTD, ESD)


Basic Information

Item Value
gene id CI01000009_07490344_07493862
gene name ESTD, ESD
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 7490248 ~ 7493862 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000009_07490344_07493862.mRNA
CTATATATCAATGAAATCTGATCTTTCATAACTCGAACTTGATTTTTCTCAGCAGAGCAATGGCACTGACGCAAGTTTCTTCTAATAAGTGCTGCAATGGATATCAGAAAGTGTTCGAGCATGACAGGTTTGACATGCACAGAGCAAAACTTCATCACTAAAGCAGGGAGCCAGCAGGCGGCTTCTGAACATGGGATCATTGTCGTAGCTCCAGACACCAGTCCACGCGGCTGCAACATTGAAGGAGAGGAGGAGAGCTGGGACTTCGGGACAGGTGCAGGATTCTACGTCAATGCCACCCAGGAGCCCTGGAAGACCAACTACCGCATGTACTCGTATGTCACAGAGGAGCTGTATGATGCTACAGTATTGGCTGAATCATATTCCGGTCCTGAGCTTGATATTCTGATTGATCAAGGCCGTGATGACCAGTTCTTGTCTTCCAGTCAGCTGCTTCCTGACAATCTGATCGCCGCCTGTTCCAATAAGAAAATTCCTGTAGTTTTCCGCCTTCAGCAGGGTTATGATCACAGCTACTATTTCATCTTCTCCTTCATCAACGACCACATCAAGCACCATGCCAAATATCTGAATGCCTGA

Function

symbol description
esd Predicted to enable S-formylglutathione hydrolase activity. Predicted to act upstream of or within formaldehyde catabolic process. Predicted to be located in cytoplasm. Predicted to be active in cytosol. Is expressed in female organism; intestinal bulb; and liver. Orthologous to human ESD (esterase D).
estd esterase

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K01070 frmB, ESD, fghA; S-formylglutathione hydrolase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000009_07490344_07493862.mRNA True 600 mRNA 0.47 5 7490248 7493862

Neighbor

gene id symbol gene type direction distance location
CI01000009_07440170_07459782 HTR2A, HTR2AA coding upstream 29839 7440039 ~ 7460409 (+)
CI01000009_07392574_07395739 MED4.S, MED4 coding upstream 94478 7392481 ~ 7395770 (+)
CI01000009_07361747_07377615 EPC2 coding upstream 111797 7361747 ~ 7378451 (+)
CI01000009_07316335_07346664 ACVR2A, ACVR2AA coding upstream 143584 7316335 ~ 7346664 (+)
CI01000009_07111833_07115320 NA coding upstream 374826 7110351 ~ 7115443 (+)
CI01000009_07543034_07544161 NA coding downstream 49172 7543034 ~ 7544161 (+)
CI01000009_07545007_07550103 NA coding downstream 51145 7545007 ~ 7550729 (+)
CI01000009_07555667_07623149 DNAH7 coding downstream 61805 7555667 ~ 7623918 (+)
CI01000009_07969738_07973990 NA coding downstream 475282 7969144 ~ 7974033 (+)
CI01000009_07982462_07999759 NA coding downstream 488388 7982250 ~ 8000306 (+)
G55032 NA non-coding upstream 3218 7486813 ~ 7487030 (+)
G55030 NA non-coding upstream 5745 7484218 ~ 7484503 (+)
G55009 NA non-coding upstream 25790 7464128 ~ 7464458 (+)
G55013 NA non-coding upstream 85913 7404075 ~ 7404335 (+)
G54999 NA non-coding upstream 193973 7296023 ~ 7296275 (+)
G55057 NA non-coding downstream 58010 7551872 ~ 7552121 (+)
G55058 NA non-coding downstream 67687 7561549 ~ 7561817 (+)
G55091 NA non-coding downstream 159057 7652919 ~ 7653350 (+)
G55328 NA non-coding downstream 230714 7724576 ~ 7724812 (+)
G55385 NA non-coding downstream 270331 7764193 ~ 7764434 (+)
G53651 NA other upstream 1241856 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 1557447 5931718 ~ 5943899 (+)
G53388 NA other upstream 1951194 5522242 ~ 5540638 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other upstream 4281264 3202207 ~ 3208984 (+)
G51529 NA other upstream 4427661 3062033 ~ 3062587 (+)
G56100 NA other downstream 1635438 9129300 ~ 9130286 (+)
CI01000009_09853929_09854476 SAP18 other downstream 2359497 9853929 ~ 9856587 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other downstream 4266924 11761606 ~ 11766944 (+)
G57811 NA other downstream 4440080 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 4938696 12432538 ~ 12436017 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location