G71618


Basic Information

Item Value
gene id G71618
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 5805801 ~ 5806063 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU81629
GAGCCTTGTAGGTCATTAGCAGTACTTTATAATCGATACGGAACTTAATAGGTAACCAGTGTAGAGATGATAAAATTGGTGTTATATGATCATATTTTCTTGACCTGGTAAGAACTCTAGCAGCTGCATTTTGTACTAACTGTAGCTTGTTTATTGAGGAAGCAGGGCAACCAGCTAGTAATGCATTACAGTAATCTAGTCTAGACGTCATGAAAGCATGAACTAACTTTTCTGCATCAGAAACAGATAACATATTCCGTATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU81629 True 263 lncRNA 0.37 1 5805801 5806063

Neighbor

gene id symbol gene type direction distance location
CI01000012_05748899_05754466 ERLEC1 coding upstream 50547 5748899 ~ 5755254 (+)
CI01000012_05708007_05735678 MAP3K4 coding upstream 69816 5708007 ~ 5735985 (+)
CI01000012_05659039_05669397 NA coding upstream 136217 5659039 ~ 5669584 (+)
CI01000012_05648602_05650699 MYCLA coding upstream 154604 5648602 ~ 5651197 (+)
CI01000012_05565127_05567009 NA coding upstream 238571 5564939 ~ 5567230 (+)
CI01000012_05856793_05862577 NA coding downstream 50253 5856316 ~ 5862642 (+)
CI01000012_05909453_05916000 MEMO1 coding downstream 103390 5909453 ~ 5916174 (+)
CI01000012_05923216_05928055 SRD5A2B coding downstream 116322 5922385 ~ 5929186 (+)
CI01000012_05946986_05984551 SLX4IP coding downstream 140923 5946986 ~ 5985959 (+)
CI01000012_06156417_06175135 NA coding downstream 348784 6154847 ~ 6175521 (+)
G71585 NA non-coding upstream 37032 5766075 ~ 5768769 (+)
G71595 NA non-coding upstream 66117 5739016 ~ 5739684 (+)
G71607 NA non-coding upstream 132544 5673042 ~ 5673257 (+)
G71606 NA non-coding upstream 133591 5671754 ~ 5672210 (+)
G71599 NA non-coding upstream 168130 5637368 ~ 5637671 (+)
G71619 NA non-coding downstream 458 5806521 ~ 5806785 (+)
G71622 NA non-coding downstream 3974 5810037 ~ 5811227 (+)
G71623 NA non-coding downstream 7454 5813517 ~ 5816605 (+)
G71637 NA non-coding downstream 37001 5843064 ~ 5843554 (+)
G71668 NA non-coding downstream 115130 5921193 ~ 5921399 (+)
G71548 NA other upstream 244368 5550493 ~ 5561433 (+)
G71221 NA other upstream 265345 5538525 ~ 5540456 (+)
G71218 NA other upstream 267417 5535852 ~ 5538384 (+)
G71199 NA other upstream 389016 5413250 ~ 5416785 (+)
CI01000012_05177587_05180517 SRSF5A other upstream 624831 5176895 ~ 5180970 (+)
CI01000012_07806089_07811902 BEND3 other downstream 2000040 7805248 ~ 7811902 (+)
G73578 NA other downstream 2560743 8366806 ~ 8367627 (+)
CI01000012_10223957_10235955 NA other downstream 4415892 10223697 ~ 10236276 (+)

Expression


Co-expression Network