G74728


Basic Information

Item Value
gene id G74728
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 8656726 ~ 8657411 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU85259
CAGAGTTTGACTCCCAGTAGCGCTGTACTTTTCTAAAAGTGAGGTTGGAGCAGTCCGACAGTCCACTAAGAAAAGTCCCAGAGGTTTTCTCTGTGAGGGCTTGATCTTCCATGGCATCTCCTGCCACATCACCGCTTCTCTGCAAAGATCCTGACTGAAGCTCATTGTGGAGTTTCAAGGCATCTACTGTCAGATCACTTTTTTCCTGAGGGACGGCTGAAATATCGGCTCCTCGCGGCTTTTCGATAGCGACATGTCTCCGGATTGCTATCACTACTGTGCCCTTTCTTCCACCGCCTTATTTTCTGGGCTGCTCCAGACTTAAGTTTTCCAGACTTCACCATTTTTGCAGGTGGAAATCCTTATAGTGCTAAGAGCACGTTGTTTTCTCCTCCAGTCTGCGTGTCGCGCTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU85259 True 415 lncRNA 0.49 2 8656726 8657411

Neighbor

gene id symbol gene type direction distance location
CI01000012_08632596_08634518 METTL18 coding downstream 22208 8632320 ~ 8634518 (-)
CI01000012_08604949_08626648 TDRD9 coding downstream 30078 8604835 ~ 8626648 (-)
CI01000012_08553489_08572819 LRRC9 coding downstream 83907 8553489 ~ 8572819 (-)
CI01000012_08532750_08542754 PCNXL4, PCNX4 coding downstream 111138 8532520 ~ 8545588 (-)
CI01000012_08520569_08525168 PPM1AA, PPM1A coding downstream 131483 8520120 ~ 8525243 (-)
CI01000012_08686460_08701212 NA coding upstream 29049 8686460 ~ 8701212 (-)
CI01000012_08712109_08714569 GDF10A coding upstream 54302 8711713 ~ 8715987 (-)
CI01000012_08745512_08773403 PTPN20 coding upstream 87816 8745227 ~ 8773403 (-)
CI01000012_08805894_08831322 ARHGAP22 coding upstream 148483 8805894 ~ 8831322 (-)
CI01000012_08841980_08849453 NA coding upstream 184110 8841521 ~ 8849557 (-)
G74767 NA non-coding downstream 44698 8611685 ~ 8612028 (-)
G74750 NA non-coding downstream 103837 8552439 ~ 8552889 (-)
G74748 NA non-coding downstream 106358 8550096 ~ 8550368 (-)
G74735 NA non-coding downstream 182399 8474051 ~ 8474327 (-)
G74733 NA non-coding downstream 238040 8418222 ~ 8418686 (-)
G74778 NA non-coding upstream 13933 8671344 ~ 8671588 (-)
G74837 NA non-coding upstream 83051 8740462 ~ 8740687 (-)
G74841 NA non-coding upstream 92819 8750230 ~ 8750446 (-)
G74842 NA non-coding upstream 99574 8756985 ~ 8757194 (-)
G74867 NA non-coding upstream 182379 8839790 ~ 8840180 (-)
G74701 NA other downstream 289083 8367019 ~ 8367643 (-)
G74648 NA other downstream 391072 8264329 ~ 8265654 (-)
CI01000012_07356934_07358497 NA other downstream 1298181 7356863 ~ 7358612 (-)
G72629 NA other downstream 2509232 6147011 ~ 6147494 (-)
G72294 NA other downstream 3190869 5462840 ~ 5465857 (-)
CI01000012_09068458_09070536 NA other upstream 410495 9067906 ~ 9070765 (-)
CI01000012_09071892_09073410 NA other upstream 413960 9071371 ~ 9073457 (-)
CI01000012_09082056_09083285 NA other upstream 425325 9081877 ~ 9083489 (-)
CI01000012_09400481_09401810 EIF4EBP2 other upstream 740665 9398076 ~ 9402378 (-)
G74982 NA other upstream 918237 9575648 ~ 9576149 (-)

Expression


Co-expression Network