G95885


Basic Information

Item Value
gene id G95885
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 5463028 ~ 5463257 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109052
CAGGCATTTACTCATCTCACTTGCACAAAACAGATTCAGTATTCCTCAAACTGAATAAAAACAGTGAAATGCAAACTCAGAATATTAGGCAAACCTGCAACAATTAACTGTTAAATTACACAAATATACTTTATGTATTTAATGTCACTTTATTAAGAAATAAACATAACATTTGTGTTTCATTTTTTTAATTGCTGAAGACTGTTGAACTTTCTTCTCCTGCATCCTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109052 True 230 lncRNA 0.30 1 5463028 5463257

Neighbor

gene id symbol gene type direction distance location
CI01000016_05445824_05454816 EPN1 coding upstream 7612 5445824 ~ 5455416 (+)
CI01000016_05405791_05407797 AICDA coding upstream 55065 5405791 ~ 5407963 (+)
CI01000016_05398036_05400369 NAT14 coding upstream 62622 5398036 ~ 5400406 (+)
CI01000016_05388832_05396460 ZNF628 coding upstream 65948 5388832 ~ 5397080 (+)
CI01000016_05381573_05383796 NA coding upstream 79210 5380917 ~ 5383818 (+)
CI01000016_05475350_05482964 U2AF2, U2AF2A, U2AF2B coding downstream 12093 5475350 ~ 5483946 (+)
CI01000016_05488887_05502270 CACNG6B coding downstream 25630 5484205 ~ 5504239 (+)
CI01000016_05698858_05706081 NA coding downstream 235601 5698858 ~ 5706719 (+)
CI01000016_05797506_05798075 NA coding downstream 334249 5797506 ~ 5799585 (+)
CI01000016_05828974_05833309 JOSD2, JOS2 coding downstream 365141 5828398 ~ 5833377 (+)
G95884 NA non-coding upstream 104 5462718 ~ 5462924 (+)
G95805 NA non-coding upstream 886 5461890 ~ 5462142 (+)
G95801 NA non-coding upstream 4821 5457842 ~ 5458207 (+)
G95880 NA non-coding upstream 28655 5425369 ~ 5434373 (+)
G95876 NA non-coding upstream 41260 5421167 ~ 5421768 (+)
G95804 NA non-coding downstream 3413 5466670 ~ 5466983 (+)
G95831 NA non-coding downstream 30984 5494241 ~ 5494914 (+)
G95888 NA non-coding downstream 33386 5496643 ~ 5496842 (+)
G95889 NA non-coding downstream 35011 5498268 ~ 5498957 (+)
G95792 NA other upstream 237087 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 626373 4829592 ~ 4837457 (+)
G95648 NA other upstream 1189123 4272636 ~ 4273905 (+)
G95439 NA other upstream 1599171 3862175 ~ 3862305 (+)
G96389 NA other downstream 1697384 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 2320808 7783987 ~ 7784996 (+)
G97824 NA other downstream 2551106 8014363 ~ 8015775 (+)
G98288 NA other downstream 3532841 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 4332374 9795950 ~ 9842576 (+)

Expression


Co-expression Network