CI01000018_02135812_02137218 (MSRB2)


Basic Information

Item Value
gene id CI01000018_02135812_02137218
gene name MSRB2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 2135750 ~ 2137218 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000018_02135812_02137218.mRNA
GTTTGCAGTCACTGACACGTTATGACCAGTCCACAGATTGGCAGAGTAAGCTGACTCCAGAACAGTATGTTGTTACAAGAGAAAAGGGCACAGAGGTGCCGTTCAGTGGCATCTACCTGAATCACAATGAGGTGGGTATGTACCACTGTGTTTGCTGTGACTCCCCTCTTTTTAGCTCAGAAGCAAAATATGATGCAGGAACTGGGTGGCCATCCTTCCATGAGGCTCACGGGACATGGGAAAAAGACGAGAGTCATGCCAACATTGTCCGTCGCCCTGACAACTCGCTTGGTAGCACAGGAACAGAGGTTATCTGCAAACATTGTGATGCCCATCTTGGACATGTCTTTGATGATGGTCCAGATCCGAATGGCCAGAGATTCTGCATCAACAGCGTAGCTCTAAACTTTAAGCCCAGAGAAAAATAATGCAGAGATATCCAGCAGTTATATCCTTGGACAGGATTTTACAGTTATACAGTACAAATAAA

Function

symbol description
msrb2 Predicted to enable actin binding activity and peptide-methionine (R)-S-oxide reductase activity. Predicted to be involved in actin filament polymerization. Predicted to act upstream of or within protein repair and response to oxidative stress. Predicted to be located in mitochondrion. Predicted to be active in cytoplasm. Orthologous to human MSRB2 (methionine sulfoxide reductase B2).

GO:

id name namespace
GO:0033743 peptide-methionine (R)-S-oxide reductase activity molecular_function

KEGG:

id description
K07305 msrB; peptide-methionine (R)-S-oxide reductase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000018_02135812_02137218.mRNA True 490 mRNA 0.46 4 2135750 2137218

Neighbor

gene id symbol gene type direction distance location
CI01000018_02129101_02134686 C8G coding downstream 1064 2128393 ~ 2134686 (-)
CI01000018_02125709_02126759 PTGDSB.1 coding downstream 8933 2125110 ~ 2126817 (-)
CI01000018_02080382_02098031 KLHL15 coding downstream 37448 2080332 ~ 2098302 (-)
CI01000018_02069280_02070789 MTRR coding downstream 64519 2069280 ~ 2071231 (-)
CI01000018_01707576_01707950 NA coding downstream 427370 1707060 ~ 1708380 (-)
CI01000018_02138741_02148435 ARMC3 coding upstream 1426 2138644 ~ 2148435 (-)
CI01000018_02195642_02198053 SKIDA1 coding upstream 56963 2193361 ~ 2199400 (-)
CI01000018_02282563_02282856 NA coding upstream 145336 2282554 ~ 2283072 (-)
CI01000018_02356445_02369996 CUL1B, CUL1A, MGC114992, CUL1.L, CUL1 coding upstream 218708 2355926 ~ 2370015 (-)
CI01000018_02381118_02382741 NA coding upstream 243680 2380898 ~ 2382749 (-)
G103867 NA non-coding downstream 19327 2115946 ~ 2116423 (-)
G103892 NA non-coding downstream 109638 2025886 ~ 2026112 (-)
G103889 NA non-coding downstream 113146 2022286 ~ 2022604 (-)
G103885 NA non-coding downstream 131143 2004342 ~ 2004607 (-)
G103855 NA non-coding downstream 149667 1985871 ~ 1986083 (-)
G103929 NA non-coding upstream 63404 2200622 ~ 2200950 (-)
G103931 NA non-coding upstream 65992 2203210 ~ 2203567 (-)
G103939 NA non-coding upstream 99641 2236859 ~ 2239022 (-)
G103944 NA non-coding upstream 127994 2265212 ~ 2265446 (-)
G103961 NA non-coding upstream 162593 2299811 ~ 2302001 (-)
G103842 NA other downstream 175692 1959497 ~ 1960058 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A other upstream 248990 2389201 ~ 2488018 (-)
G104968 NA other upstream 1344886 3482104 ~ 3500514 (-)
G105104 NA other upstream 1870479 4007697 ~ 4017817 (-)
G105200 NA other upstream 2106249 4243467 ~ 4246010 (-)
CI01000018_04856240_04875704 DAP other upstream 2717863 4855081 ~ 4876532 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location