G103836


Basic Information

Item Value
gene id G103836
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 1943351 ~ 1950908 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU118105
CTGGAGCAGTTTGCCACCTCAACACTGATTCCTTGGCACGGTTGCCCTCCACACTGAGGGCTCGGGCTGTCACAGGCTCGAGTCCGACACTGGCATGAACCAATACTGCCGCCATCGCTGTGACTACAAGCTTTCCATCCCGACCAGGCTCCAAAGTGACCATCCACAGTCACGTTTCTCACAGGACAACGTGTGATGCTCTGCTCCCATTGGCTCATGCTGATGCTCTCTTCCAGGGTGGTGCATTTCTTGAGAACCAGATCCCAGCCGCAGTACGGATCCCTGGCCCCCACACAGGCATCTCTAGACTTGTGGAAGTTGCAGCGCATCAGGGGGATTTTGATGACCTGGTCTCTGACTCCAACAAATAGCTCACTGCGGCTGTGAAGTATAAGCAGGCTGCGGATTGGCTGCCTCTTCTTCAGAGGGAAAAGCTCAATCTCATCCAGCAAACAGCTGCCCATGGTCTGGTTCAGCGGGGAGAGGACCTTCTTAATGGTGCCGTAATCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU118105 True 510 lncRNA 0.55 3 1943351 1950908

Neighbor

gene id symbol gene type direction distance location
CI01000018_01707576_01707950 NA coding downstream 234971 1707060 ~ 1708380 (-)
CI01000018_01583609_01585366 CBLN2A, CBLN2, CBLN2B coding downstream 357182 1582910 ~ 1586169 (-)
CI01000018_01307800_01363530 RTTN coding downstream 579418 1306982 ~ 1363933 (-)
CI01000018_01286376_01296170 NA coding downstream 647181 1285588 ~ 1296170 (-)
CI01000018_01030816_01076302 JPH1A coding downstream 867049 1029837 ~ 1076302 (-)
CI01000018_02069280_02070789 MTRR coding upstream 118372 2069280 ~ 2071231 (-)
CI01000018_02080382_02098031 KLHL15 coding upstream 129424 2080332 ~ 2098302 (-)
CI01000018_02125709_02126759 PTGDSB.1 coding upstream 174202 2125110 ~ 2126817 (-)
CI01000018_02129101_02134686 C8G coding upstream 177485 2128393 ~ 2134686 (-)
CI01000018_02135812_02137218 MSRB2 coding upstream 184842 2135750 ~ 2137218 (-)
G103816 NA non-coding downstream 4057 1935753 ~ 1939294 (-)
G103814 NA non-coding downstream 7949 1935130 ~ 1935402 (-)
G103835 NA non-coding downstream 10602 1932379 ~ 1932749 (-)
G103815 NA non-coding downstream 12194 1930944 ~ 1931157 (-)
G103833 NA non-coding downstream 15180 1927825 ~ 1928171 (-)
G103837 NA non-coding upstream 325 1951233 ~ 1951578 (-)
G103838 NA non-coding upstream 861 1951769 ~ 1951977 (-)
G103841 NA non-coding upstream 4395 1955303 ~ 1955542 (-)
G103843 NA non-coding upstream 10442 1961350 ~ 1961638 (-)
G103844 NA non-coding upstream 12702 1963610 ~ 1963932 (-)
G103842 NA other upstream 8589 1959497 ~ 1960058 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A other upstream 435300 2389201 ~ 2488018 (-)
G104968 NA other upstream 1531196 3482104 ~ 3500514 (-)
G105104 NA other upstream 2056789 4007697 ~ 4017817 (-)
G105200 NA other upstream 2292559 4243467 ~ 4246010 (-)

Expression


Co-expression Network