G107875


Basic Information

Item Value
gene id G107875
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000019
NCBI id null
chromosome length 5832599
location 1609307 ~ 1609521 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU122655
TGTGACAGGGTGGTATGGACAAAGTGTTTTTCTATATAATCTGCTGGTTTTAAACTTTAAAAACTGGGGGAGGGGAGACATTCAAATTGAGTAAAAAGTGTGTGAGTGAGTGAGTGAGTGAGTGAGTGAAAAAACCAAAGTGTTGCCAAGTCTGCGGTTTTCCCGAGGAATTGGGCTACTTTTACACTGTTGCCGCTGGTTGTTTTTCATGTCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU122655 True 215 lncRNA 0.42 1 1609307 1609521

Neighbor

gene id symbol gene type direction distance location
CI01000019_01580774_01598483 PRKCQ coding downstream 10300 1580648 ~ 1599007 (-)
CI01000019_01503557_01515831 NA coding downstream 91838 1503466 ~ 1517469 (-)
CI01000019_01444034_01465802 NA coding downstream 142876 1443821 ~ 1466431 (-)
CI01000019_01397591_01406229 NA coding downstream 202885 1397467 ~ 1406422 (-)
CI01000019_01367542_01396290 LAMB1B coding downstream 213017 1367524 ~ 1396290 (-)
CI01000019_01660708_01661966 NA coding upstream 50196 1659717 ~ 1661970 (-)
CI01000019_01676776_01677954 NA coding upstream 67142 1676663 ~ 1678572 (-)
CI01000019_01701100_01714662 ITIH5 coding upstream 89887 1699408 ~ 1715168 (-)
CI01000019_01734247_01739663 KIN coding upstream 124726 1734247 ~ 1739663 (-)
CI01000019_02485969_02486810 NA coding upstream 875793 2485314 ~ 2486846 (-)
G107839 NA non-coding downstream 28776 1578124 ~ 1580531 (-)
G107833 NA non-coding downstream 48740 1551278 ~ 1560567 (-)
G107863 NA non-coding downstream 58627 1550439 ~ 1550680 (-)
G107831 NA non-coding downstream 78854 1530214 ~ 1530453 (-)
G107830 NA non-coding downstream 79137 1529598 ~ 1530170 (-)
G107881 NA non-coding upstream 11755 1621276 ~ 1621570 (-)
G107882 NA non-coding upstream 12075 1621596 ~ 1621871 (-)
G107883 NA non-coding upstream 12464 1621985 ~ 1622321 (-)
G107885 NA non-coding upstream 13709 1623230 ~ 1623434 (-)
G107893 NA non-coding upstream 106660 1716181 ~ 1716541 (-)
G107820 NA other downstream 130166 1478851 ~ 1479141 (-)
G107779 NA other downstream 185490 1423565 ~ 1423817 (-)
G109437 NA other upstream 730682 2340203 ~ 2340758 (-)
CI01000019_03618642_03619707 NDUFB2 other upstream 2008867 3618388 ~ 3619973 (-)
G110029 NA other upstream 2251480 3861001 ~ 4015766 (-)
CI01000019_05571685_05572535 LAMTOR4 other upstream 3961419 5570940 ~ 5572535 (-)

Expression


Co-expression Network