G109478


Basic Information

Item Value
gene id G109478
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000019
NCBI id null
chromosome length 5832599
location 2417472 ~ 2417750 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU124387
GCAATTGGGAACAACAGCAACTCAGCCACGAAGTGGTAGGCCATGTAAAATCACAGAGCGGGGTCAGCGCATGCTGAGGCGCACAGTGCACAGAAGTCGCCAACTTTCTGCAGAGTCAATAGCTACAGACCTCCAGACTTCGTGTGGCCTTCAGATTAGCTCAAGAACAGTACGTAGAGAGCTTCATGGAATGGGTTTCCATGGCTGAGCAGCTGCATCCAAGCTTTACATCACCAAGTGCAATGCAAAGCGTCGGATGCAGTGGTGTAAAGCATGCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU124387 True 279 lncRNA 0.52 1 2417472 2417750

Neighbor

gene id symbol gene type direction distance location
CI01000019_01734247_01739663 KIN coding downstream 677809 1734247 ~ 1739663 (-)
CI01000019_01701100_01714662 ITIH5 coding downstream 702304 1699408 ~ 1715168 (-)
CI01000019_01676776_01677954 NA coding downstream 738900 1676663 ~ 1678572 (-)
CI01000019_01660708_01661966 NA coding downstream 755502 1659717 ~ 1661970 (-)
CI01000019_01580774_01598483 PRKCQ coding downstream 818465 1580648 ~ 1599007 (-)
CI01000019_02485969_02486810 NA coding upstream 67564 2485314 ~ 2486846 (-)
CI01000019_02502701_02503852 NA coding upstream 84473 2502223 ~ 2503874 (-)
CI01000019_02601366_02629849 NA coding upstream 183309 2601059 ~ 2631149 (-)
CI01000019_02893150_02903846 NA coding upstream 475323 2891564 ~ 2903926 (-)
CI01000019_02907262_02983656 NA coding upstream 489420 2907170 ~ 2985939 (-)
G109473 NA non-coding downstream 9251 2407995 ~ 2408221 (-)
G109470 NA non-coding downstream 13452 2403814 ~ 2404020 (-)
G109459 NA non-coding downstream 35900 2381350 ~ 2381572 (-)
G109457 NA non-coding downstream 46469 2370767 ~ 2371003 (-)
G109452 NA non-coding downstream 55584 2361045 ~ 2361888 (-)
G109479 NA non-coding upstream 530 2418280 ~ 2418489 (-)
G109486 NA non-coding upstream 33003 2450753 ~ 2454554 (-)
G109480 NA non-coding upstream 56371 2474121 ~ 2476984 (-)
G109519 NA non-coding upstream 63005 2480755 ~ 2482731 (-)
G109521 NA non-coding upstream 70541 2488291 ~ 2491656 (-)
G109437 NA other downstream 76714 2340203 ~ 2340758 (-)
CI01000019_01503557_01515831 NA other downstream 899635 1503466 ~ 1517469 (-)
G107820 NA other downstream 938331 1478851 ~ 1479141 (-)
G107779 NA other downstream 993655 1423565 ~ 1423817 (-)
CI01000019_03618642_03619707 NDUFB2 other upstream 1200638 3618388 ~ 3619973 (-)
G110029 NA other upstream 1443251 3861001 ~ 4015766 (-)
CI01000019_05571685_05572535 LAMTOR4 other upstream 3153190 5570940 ~ 5572535 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
mexican tetra (Astyanax mexicanus) G104649 NA non-coding NC_035908.1 CM008311.1 18896411 ~ 18896687 (-)