G116771



Basic Information


Item Value
gene id G116771
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 1514326 ~ 1514529 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU132663
GTTTCCTGTGTGTTGACATGCGTTTGCCAAGGTTTTCTGAGCAGTTGTTAGCATGTTGCTCTGCGGTTGCTGGACTCTTCTGAGTGGTTTTTCGTGGTGCTACGTGGTTGTTAGGATGTTTTGAGCGGTTGGTTGACATGCGGATGCTTTTAAAGAGTTGGGTTAGGGTAGGTTAGGGTCCCTCACATGGTTTGCAGCTTGACG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU132663 True 204 lncRNA 0.49 1 1514326 1514529

Neighbor


gene id symbol gene type direction distance location
CI01000021_01494163_01497702 DDX23 coding downstream 16624 1493783 ~ 1497702 (-)
CI01000021_01475454_01477318 NA coding downstream 36741 1475400 ~ 1482389 (-)
CI01000021_01338516_01408458 ADCY6B, ADCY6, ADCY6A coding downstream 105868 1338516 ~ 1408458 (-)
CI01000021_01324700_01331200 NA coding downstream 182815 1323851 ~ 1331511 (-)
CI01000021_01307370_01312008 G6PDH, G6PD coding downstream 202318 1306309 ~ 1312008 (-)
CI01000021_01535275_01607587 NA coding upstream 20746 1535275 ~ 1607587 (-)
CI01000021_01610076_01611493 NA coding upstream 95496 1610025 ~ 1611760 (-)
CI01000021_01626896_01630224 LIME1 coding upstream 112333 1626862 ~ 1630224 (-)
CI01000021_01735408_01735712 NA coding upstream 220734 1735263 ~ 1735712 (-)
CI01000021_01791577_01796792 SLA2 coding upstream 276868 1791397 ~ 1796792 (-)
G116763 NA non-coding downstream 28099 1485938 ~ 1486227 (-)
G116760 NA non-coding downstream 29703 1484079 ~ 1484623 (-)
G116625 NA non-coding downstream 140460 1363447 ~ 1373866 (-)
G116611 NA non-coding downstream 228625 1285191 ~ 1285701 (-)
G116819 NA non-coding upstream 222423 1736952 ~ 1737467 (-)
G116802 NA non-coding upstream 250273 1764802 ~ 1769067 (-)
G116833 NA non-coding upstream 271689 1786218 ~ 1786973 (-)
G116834 NA non-coding upstream 272770 1787299 ~ 1787682 (-)
G116805 NA non-coding upstream 296317 1810846 ~ 1811339 (-)
G116730 NA other downstream 151522 1361878 ~ 1362804 (-)
G116856 NA other upstream 695392 2209921 ~ 2210496 (-)
G116893 NA other upstream 816785 2331314 ~ 2334316 (-)
G116997 NA other upstream 1198256 2712785 ~ 2713247 (-)
G117683 NA other upstream 1377331 2891860 ~ 2892359 (-)
G117893 NA other upstream 1529490 3044019 ~ 3044787 (-)

Expression



Co-expression Network