G119394


Basic Information

Item Value
gene id G119394
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 6098520 ~ 6098780 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU135591
GCCCATGCCACACGCACTCATGCAACCCCATACCATCAGAGATGCAGGCTTCTGAACTGAGCGCTGATAACAACTTGGGTTGTCCTTGTCCTCTTTAGTCCGGATGACATGGCGTCCCAGTTTTCCAAAAAGAACTTCAAATTTTAATTCGTCTGACCACAGAACAGTTTTCCACTTTGCCACAGTCCATTTTAAATGAACCTTGGCCCAGAGAAAACGCCTGCGCTTCTGGATCATGTTTAGATATGGCTTCTTTTTTGA

Function

NR:

description
PREDICTED: sodium/potassium-transporting ATPase subunit alpha-1-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU135591 True 261 lncRNA 0.46 1 6098520 6098780

Neighbor

gene id symbol gene type direction distance location
CI01000021_06077681_06095590 NA coding upstream 2794 6077409 ~ 6095726 (+)
CI01000021_06069397_06074082 FBXO30B coding upstream 24371 6069242 ~ 6074149 (+)
CI01000021_06009872_06060664 NA coding upstream 37649 6009872 ~ 6060871 (+)
CI01000021_05980937_05993618 NA coding upstream 104596 5980937 ~ 5993924 (+)
CI01000021_05852098_05854690 NA coding upstream 243379 5852098 ~ 5855141 (+)
CI01000021_06266751_06267607 NA coding downstream 166186 6264966 ~ 6268158 (+)
CI01000021_06408474_06411089 NA coding downstream 309694 6408474 ~ 6411089 (+)
CI01000021_06411964_06421511 NA coding downstream 313184 6411964 ~ 6421511 (+)
CI01000021_06423446_06426296 NA coding downstream 324666 6423446 ~ 6427608 (+)
CI01000021_06427686_06431101 NA coding downstream 328906 6427686 ~ 6431753 (+)
G119395 NA non-coding upstream 218 6098101 ~ 6098302 (+)
G119099 NA non-coding upstream 119009 5975154 ~ 5979511 (+)
G119098 NA non-coding upstream 126477 5971767 ~ 5972043 (+)
G119091 NA non-coding upstream 129269 5968860 ~ 5969251 (+)
G119100 NA non-coding upstream 141096 5956642 ~ 5957424 (+)
G119398 NA non-coding downstream 5275 6104055 ~ 6104323 (+)
G119440 NA non-coding downstream 72015 6170795 ~ 6171029 (+)
G119443 NA non-coding downstream 75054 6173834 ~ 6174033 (+)
G119429 NA non-coding downstream 79360 6178140 ~ 6182356 (+)
G119450 NA non-coding downstream 92319 6191099 ~ 6191934 (+)
CI01000021_04886787_04893309 PLAGL2 other upstream 1209012 4886337 ~ 4893474 (+)
G117493 NA other upstream 2062844 4033000 ~ 4035676 (+)
G117484 NA other upstream 2140768 3956146 ~ 3957752 (+)
G117202 NA other upstream 2770287 3269144 ~ 3328233 (+)
G117237 NA other upstream 2855156 3237854 ~ 3243364 (+)
G119701 NA other downstream 701364 6800144 ~ 6860606 (+)

Expression


Co-expression Network