G126591


Basic Information

Item Value
gene id G126591
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 906041 ~ 912060 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU143811
CTCAAAGTAGCAGTCGTATCCTTCAGGTGAAGCTTTCTTCAGTGCTTCCTCCAGTGAGGAGACAGTCTTATAGTTAAAGGCCTGGTCAAAGCCCAGCTCCTTCAGGTATGCCACCTTGTTATCACTTCCTGCGGAACCCACAACCTTGCAGCCTTTAAGTTTGGCAATTTGACCGGCTACAGAGCCCACCGCCCCTGCGGCTGCATTCACCAGTAAGGTTTCTCCTGATTTGATGGCACAGACCTCCTCCAAACCGTAGAGTGCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU143811 True 266 lncRNA 0.52 2 906041 912060

Neighbor

gene id symbol gene type direction distance location
CI01000026_00812986_00894233 SVEP1 coding upstream 11808 812986 ~ 894233 (+)
CI01000026_00776867_00777588 NEDD8, BRAFLDRAFT_284180, NEDD8L, NEDD8.S coding upstream 128211 776757 ~ 777830 (+)
CI01000026_00736709_00743165 LRP10 coding upstream 162253 736535 ~ 743788 (+)
CI01000026_00712126_00713370 MRPL52 coding upstream 192655 712085 ~ 713386 (+)
CI01000026_00678603_00703293 ACIN1B coding upstream 202407 677693 ~ 703634 (+)
CI01000026_00917354_00920865 HAUS3 coding downstream 5294 917354 ~ 920921 (+)
CI01000026_00921518_00975614 POLN coding downstream 9458 921518 ~ 975786 (+)
CI01000026_01003422_01010038 NELFA, NELFA.L coding downstream 91362 1003422 ~ 1010599 (+)
CI01000026_01024484_01025519 NA coding downstream 112424 1024484 ~ 1025782 (+)
CI01000026_01028747_01045377 NA coding downstream 116687 1028747 ~ 1045377 (+)
G126637 NA non-coding upstream 103520 802318 ~ 802521 (+)
G126566 NA non-coding upstream 136958 768035 ~ 769083 (+)
G126565 NA non-coding upstream 140100 765700 ~ 765941 (+)
G126564 NA non-coding upstream 141970 763782 ~ 764071 (+)
G126562 NA non-coding upstream 142824 762573 ~ 763217 (+)
G126620 NA non-coding downstream 22758 934818 ~ 935310 (+)
G126655 NA non-coding downstream 25855 937915 ~ 938141 (+)
G126656 NA non-coding downstream 26151 938211 ~ 938457 (+)
G126621 NA non-coding downstream 30694 942754 ~ 943575 (+)
G126606 NA non-coding downstream 305510 1217570 ~ 1223355 (+)
G126556 NA other upstream 150878 754791 ~ 755163 (+)
G127500 NA other downstream 1019123 1931183 ~ 1946439 (+)
G127531 NA other downstream 1397262 2309322 ~ 2312135 (+)
G127519 NA other downstream 1481623 2393683 ~ 2427006 (+)
CI01000026_02659356_02660297 NA other downstream 1747155 2658605 ~ 2660829 (+)
G127979 NA other downstream 2840491 3752551 ~ 3762986 (+)

Expression


Co-expression Network