G134498


Basic Information

Item Value
gene id G134498
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 12076243 ~ 12076728 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU152943
GGATCATCTTAATGATGCTAATTATTTCTGATAGTGATAGGCCTACTCATCTATTTTGCTTGATGAAATGCGATTTTACCACATGCTCTGCAACCATATCATCAGGCTACCTTCAGGAGTATCCAGTCAATGTTTGAAAGTAATACAAACAGCTCGTGTGGACGTCCACCTCAGCACTTCCATAATGACTGCAAGATGATAACATGCATATCACATACTTCGCTTTTATGGGTGTTTTTTTGTAAAAGAAGTCTCATGGTTGTGGACTTATATCACTGGTGTTGGCTCGTTCATCCTCGGAGGAACAATCAGATGAATTCAGCATGTAATTGTCTCCTTCTTCGTCGTCACTGTCTCTGAAGTCCCGTATTCTGTTACTTTTCACTGAATCTACCTTCTGGTAGTCCTTCTCTAGTCCGTCCATTTTGTCCTGGTTTCCTTTACCTTTCTGCTTCTCGGCCTCCTGGGCGGCTTGTTCTTTTGCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU152943 True 486 lncRNA 0.42 1 12076243 12076728

Neighbor

gene id symbol gene type direction distance location
CI01000026_12036990_12067506 UBE3C coding downstream 7385 12036648 ~ 12068858 (-)
CI01000026_12008640_12024213 DNAJB6B coding downstream 52030 12008555 ~ 12024213 (-)
CI01000026_11747661_11754397 NA coding downstream 321024 11746800 ~ 11755219 (-)
CI01000026_11745584_11746257 NA coding downstream 329535 11744948 ~ 11746708 (-)
CI01000026_11682328_11694593 SHRPRBCK1R, SHARPIN coding downstream 381243 11681667 ~ 11695000 (-)
CI01000026_12079761_12087407 NOM1 coding upstream 2679 12079407 ~ 12088424 (-)
CI01000026_12132260_12141706 RNF32 coding upstream 55213 12131941 ~ 12141706 (-)
CI01000026_12220025_12255410 RBM33 coding upstream 143297 12220025 ~ 12255410 (-)
CI01000026_12289057_12291515 EN2, ENG2A coding upstream 212208 12288936 ~ 12293418 (-)
CI01000026_12309243_12313256 INSIG1 coding upstream 232469 12309197 ~ 12313425 (-)
G134491 NA non-coding downstream 75016 12000949 ~ 12001227 (-)
G134490 NA non-coding downstream 80068 11995897 ~ 11996175 (-)
G134489 NA non-coding downstream 80876 11994619 ~ 11995367 (-)
G134487 NA non-coding downstream 82914 11993126 ~ 11993329 (-)
G134486 NA non-coding downstream 85360 11990540 ~ 11990883 (-)
G134536 NA non-coding upstream 73797 12150525 ~ 12150785 (-)
G134577 NA non-coding upstream 241846 12318574 ~ 12318816 (-)
G134578 NA non-coding upstream 244503 12321231 ~ 12321504 (-)
G134579 NA non-coding upstream 245037 12321765 ~ 12322255 (-)
G134580 NA non-coding upstream 248561 12325289 ~ 12352296 (-)
G133802 NA other downstream 769062 11301915 ~ 11307181 (-)
G133790 NA other downstream 1238638 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 1286089 10787339 ~ 10789709 (-)
CI01000026_10347872_10351783 CEBPA other downstream 1727286 10347746 ~ 10351783 (-)
G132721 NA other downstream 2525599 9550030 ~ 9550644 (-)
G136110 NA other upstream 2478189 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 4680001 16756729 ~ 16761341 (-)
G137667 NA other upstream 4729636 16806364 ~ 16808372 (-)
G137914 NA other upstream 4906523 16983251 ~ 16984352 (-)
G137967 NA other upstream 4991620 17068348 ~ 17069433 (-)

Expression


Co-expression Network