G135223


Basic Information

Item Value
gene id G135223
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 13620107 ~ 13620327 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU153766
AAAAGAAAGAAATGTTTTTGAGGAAAACATTCCAGGATTTTTCTCCATATAGTGGACTTCATCGGCTACCAATGGTTTGAAGGTCCAAATTGAAGTTTCAGTGCAGCTTCAAAGGGTTCTACACGATCCCAGCCGAGGAATAAGGGTCTTATCTAGCAAAACGATCGGTCATTTTCTAAGATAAATAAAAATGTATATACATTTTAACCACAAATGTGCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU153766 True 221 lncRNA 0.37 1 13620107 13620327

Neighbor

gene id symbol gene type direction distance location
CI01000026_13299234_13300178 NA coding downstream 319167 13298482 ~ 13300940 (-)
CI01000026_13082079_13210565 ITFG1 coding downstream 409542 13082079 ~ 13210565 (-)
CI01000026_13053390_13065531 NETO2 coding downstream 554576 13051213 ~ 13065531 (-)
CI01000026_13039331_13039570 NA coding downstream 580537 13039271 ~ 13039570 (-)
CI01000026_13033698_13034704 NA coding downstream 584487 13033625 ~ 13035620 (-)
CI01000026_13744060_13791879 CDH8 coding upstream 123733 13744060 ~ 13791879 (-)
CI01000026_14156809_14170720 CDH11 coding upstream 536022 14156349 ~ 14170720 (-)
CI01000026_14376741_14381102 NA coding upstream 756243 14376570 ~ 14382093 (-)
CI01000026_14680424_14682203 TK2 coding upstream 1060032 14680359 ~ 14682203 (-)
CI01000026_14684215_14684738 NA coding upstream 1063876 14684203 ~ 14685091 (-)
G135053 NA non-coding downstream 294706 13325191 ~ 13325401 (-)
G135043 NA non-coding downstream 315529 13304295 ~ 13304578 (-)
G135007 NA non-coding downstream 424125 13195267 ~ 13195982 (-)
G134986 NA non-coding downstream 602029 13017868 ~ 13018078 (-)
G135241 NA non-coding upstream 24453 13644780 ~ 13645099 (-)
G135243 NA non-coding upstream 33107 13653434 ~ 13653653 (-)
G135430 NA non-coding upstream 296130 13916457 ~ 13916873 (-)
G135431 NA non-coding upstream 296789 13917116 ~ 13917382 (-)
G135448 NA non-coding upstream 345630 13965957 ~ 13966225 (-)
G133802 NA other downstream 2312926 11301915 ~ 11307181 (-)
G133790 NA other downstream 2782502 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 2829953 10787339 ~ 10789709 (-)
CI01000026_10347872_10351783 CEBPA other downstream 3271150 10347746 ~ 10351783 (-)
G132721 NA other downstream 4069463 9550030 ~ 9550644 (-)
G136110 NA other upstream 934590 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 3136402 16756729 ~ 16761341 (-)
G137667 NA other upstream 3186037 16806364 ~ 16808372 (-)
G137914 NA other upstream 3362924 16983251 ~ 16984352 (-)
G137967 NA other upstream 3448021 17068348 ~ 17069433 (-)

Expression


Co-expression Network