G135241


Basic Information

Item Value
gene id G135241
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 13644780 ~ 13645099 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU153784
TAAAAATACCACAGAAATTGAACAATGAAATATAAAATAACTCTGCATAGTCATAACTGTATAAATTAAATATTGATTAATCCTTATTAAAGCTTTTCTTTTGTTATTTGATTATCATTTATGATACAGACCGCCATAGTAGACAGTAGCGCTAGACAGGAGACACTGCTGTCATTATAATGGACGGAGACAATATGCTGTTACACATGCTGTTCACATTCACATAACCAACGCGAATATATGCCAAGACGGGCATTTTGACATAACTGATGTGTATTTGAACGTTTATGTGTAATAAACCGCGAAAATCTGACACTCGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU153784 True 320 lncRNA 0.34 1 13644780 13645099

Neighbor

gene id symbol gene type direction distance location
CI01000026_13299234_13300178 NA coding downstream 343840 13298482 ~ 13300940 (-)
CI01000026_13082079_13210565 ITFG1 coding downstream 434215 13082079 ~ 13210565 (-)
CI01000026_13053390_13065531 NETO2 coding downstream 579249 13051213 ~ 13065531 (-)
CI01000026_13039331_13039570 NA coding downstream 605210 13039271 ~ 13039570 (-)
CI01000026_13033698_13034704 NA coding downstream 609160 13033625 ~ 13035620 (-)
CI01000026_13744060_13791879 CDH8 coding upstream 98961 13744060 ~ 13791879 (-)
CI01000026_14156809_14170720 CDH11 coding upstream 511250 14156349 ~ 14170720 (-)
CI01000026_14376741_14381102 NA coding upstream 731471 14376570 ~ 14382093 (-)
CI01000026_14680424_14682203 TK2 coding upstream 1035260 14680359 ~ 14682203 (-)
CI01000026_14684215_14684738 NA coding upstream 1039104 14684203 ~ 14685091 (-)
G135223 NA non-coding downstream 24453 13620107 ~ 13620327 (-)
G135053 NA non-coding downstream 319379 13325191 ~ 13325401 (-)
G135043 NA non-coding downstream 340202 13304295 ~ 13304578 (-)
G135007 NA non-coding downstream 448798 13195267 ~ 13195982 (-)
G135243 NA non-coding upstream 8335 13653434 ~ 13653653 (-)
G135430 NA non-coding upstream 271358 13916457 ~ 13916873 (-)
G135431 NA non-coding upstream 272017 13917116 ~ 13917382 (-)
G135448 NA non-coding upstream 320858 13965957 ~ 13966225 (-)
G135456 NA non-coding upstream 334945 13980044 ~ 13980291 (-)
G133802 NA other downstream 2337599 11301915 ~ 11307181 (-)
G133790 NA other downstream 2807175 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 2854626 10787339 ~ 10789709 (-)
CI01000026_10347872_10351783 CEBPA other downstream 3295823 10347746 ~ 10351783 (-)
G132721 NA other downstream 4094136 9550030 ~ 9550644 (-)
G136110 NA other upstream 909818 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 3111630 16756729 ~ 16761341 (-)
G137667 NA other upstream 3161265 16806364 ~ 16808372 (-)
G137914 NA other upstream 3338152 16983251 ~ 16984352 (-)
G137967 NA other upstream 3423249 17068348 ~ 17069433 (-)

Expression


Co-expression Network