G139360


Basic Information

Item Value
gene id G139360
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 1007194 ~ 1007422 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU158358
ATTTAAAGTAGCGTCTGATTAATAAAAATCTGTTAAAATGGAAGAAACTGAACTAGAAAAATGGGTTCTGACCTATACCATTAATATCACAACATTTATTATGTCACGACAAATACTGCAAAATGCCTTGTGATGGTCTTAATACACTTTAATCATCTACAGTTTTTTAGGATTCTCATTTTTGACCAGTGAATCTCACATTTCCAGTAGTGATTACAGGATAAAGTTT

Function

NR:

description
PREDICTED: zinc finger protein 184-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU158358 True 229 lncRNA 0.31 1 1007194 1007422

Neighbor

gene id symbol gene type direction distance location
CI01000027_00823197_00901936 THSD7AA, THSD7A coding downstream 105258 822225 ~ 901936 (-)
CI01000027_00808322_00809068 NA coding downstream 198126 808068 ~ 809068 (-)
CI01000027_00798826_00806532 ICA1 coding downstream 200662 798686 ~ 806532 (-)
CI01000027_00742700_00758723 COL28A1B coding downstream 248471 742631 ~ 758723 (-)
CI01000027_00701871_00719591 COL28A1B coding downstream 287603 701766 ~ 719591 (-)
CI01000027_01059994_01067301 RAB11A, RAB11AL, RAB25, RB11A coding upstream 51506 1058928 ~ 1067361 (-)
CI01000027_01072444_01076227 RAB25B, RAB25, RAA2A, RAB25A coding upstream 64593 1072015 ~ 1076227 (-)
CI01000027_01078554_01079951 MAPIP, ROBLD3-PS1, LAMTOR2.L, LAMTOR2.S, LAMTOR2 coding upstream 71014 1078436 ~ 1079951 (-)
CI01000027_01082314_01087880 UBQL4, XDRP1, UBQLN1, UBQLN4 coding upstream 74527 1081949 ~ 1088604 (-)
CI01000027_01111716_01114630 NA coding upstream 104256 1111678 ~ 1115560 (-)
G139359 NA non-coding downstream 1783 1005169 ~ 1005411 (-)
G139354 NA non-coding downstream 22450 984490 ~ 984744 (-)
CI01000027_00645077_00650763 SLC25A32B, SLC25A32 non-coding downstream 361749 644241 ~ 651285 (-)
G139294 NA non-coding downstream 384067 620674 ~ 623127 (-)
G139364 NA non-coding upstream 20847 1028269 ~ 1029875 (-)
G139373 NA non-coding upstream 36619 1044041 ~ 1044379 (-)
G139382 NA non-coding upstream 101128 1108550 ~ 1108876 (-)
G139405 NA non-coding upstream 152624 1160046 ~ 1160265 (-)
G139117 NA other downstream 769615 234212 ~ 237579 (-)
CI01000027_00131884_00132650 NA other downstream 873392 131395 ~ 132650 (-)
CI01000027_00108990_00118237 NA other downstream 888891 108119 ~ 118408 (-)
CI01000027_01241417_01245177 NA other upstream 237213 1240478 ~ 1246267 (-)
CI01000027_01303308_01319462 NR2F5, NR2F1, NR2F1.L, NR2F2 other upstream 294612 1302034 ~ 1321178 (-)
CI01000027_02119227_02124423 NA other upstream 1114708 2119131 ~ 2125142 (-)
CI01000027_02226447_02227499 NA other upstream 1219203 2225781 ~ 2227499 (-)
G140118 NA other upstream 2494112 3509352 ~ 3584679 (-)

Expression


Co-expression Network