CI01000027_01078554_01079951 (MAPIP, ROBLD3-PS1, LAMTOR2.L, LAMTOR2.S, LAMTOR2)


Basic Information

Item Value
gene id CI01000027_01078554_01079951
gene name MAPIP, ROBLD3-PS1, LAMTOR2.L, LAMTOR2.S, LAMTOR2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 1078436 ~ 1079951 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000027_01078554_01079951.mRNA
TTAACTCTAGGCCACGGTTTTGTAGTTCGTAGGCACTACCATGACACTACATTTCCCATGAATCATCAGCGCGGAACATTAACACAAGTACTCAGTCAAGCAAACACCAGCGGAGTACAAAGCACGCTGTTATTGAACAATGAAGGCTCCCTGTTGGCATATTCTGGATATGGAGACACCGATGCAAGAGTCACTGCAGCCATTGCCAGCAACATATGGGCAGCTTACGACAAAAACGGACACCAGGCCTTTAATGAGGACAAACTGAAATTCATACTGATGGATTGTATGGAGGGAAGGGTGGCCATTACACGTGTTGCTAACTTGTTGCTTTGCATGTATGCCAAGGAGACAGTCGGCTTTGGGATGCTTAAAGCCAAGGCCGAGGCTTTAGTGCAGTACCTTGAGGAACCACTAACACAAGTGGCAGCGTCGTAGGATCTACTTTGACGTGTGGATTTGTGTACAAGATCTTGGCCTCTATACAATAATATCTATGGCTTTATTTATTTGCATACTCAAGTTGATTGTTGTATCAAATTAAGTGGTTATTAAA

Function

symbol description
lamtor2 Predicted to contribute to guanyl-nucleotide exchange factor activity and molecular adaptor activity. Predicted to be involved in several processes, including cellular response to amino acid stimulus; positive regulation of TOR signaling; and regulation of cell growth. Predicted to be located in late endosome. Predicted to be part of Ragulator complex. Orthologous to human LAMTOR2 (late endosomal/lysosomal adaptor, MAPK and MTOR activator 2).

GO:

id name namespace
GO:0000186 activation of MAPKK activity biological_process

KEGG:

id description
K20398 LAMTOR2; ragulator complex protein LAMTOR2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000027_01078554_01079951.mRNA True 556 mRNA 0.44 5 1078436 1079951

Neighbor

gene id symbol gene type direction distance location
CI01000027_01072444_01076227 RAB25B, RAB25, RAA2A, RAB25A coding downstream 2209 1072015 ~ 1076227 (-)
CI01000027_01059994_01067301 RAB11A, RAB11AL, RAB25, RB11A coding downstream 11075 1058928 ~ 1067361 (-)
CI01000027_00823197_00901936 THSD7AA, THSD7A coding downstream 176500 822225 ~ 901936 (-)
CI01000027_00808322_00809068 NA coding downstream 269368 808068 ~ 809068 (-)
CI01000027_00798826_00806532 ICA1 coding downstream 271904 798686 ~ 806532 (-)
CI01000027_01082314_01087880 UBQL4, XDRP1, UBQLN1, UBQLN4 coding upstream 1998 1081949 ~ 1088604 (-)
CI01000027_01111716_01114630 NA coding upstream 31727 1111678 ~ 1115560 (-)
CI01000027_01198110_01199285 RPZ4 coding upstream 117539 1197490 ~ 1200933 (-)
CI01000027_01204940_01206121 RPZ5 coding upstream 124518 1204469 ~ 1206319 (-)
CI01000027_01232167_01232844 NA coding upstream 151606 1231557 ~ 1234381 (-)
G139373 NA non-coding downstream 34057 1044041 ~ 1044379 (-)
G139364 NA non-coding downstream 48561 1028269 ~ 1029875 (-)
G139360 NA non-coding downstream 71014 1007194 ~ 1007422 (-)
G139359 NA non-coding downstream 73025 1005169 ~ 1005411 (-)
G139354 NA non-coding downstream 93692 984490 ~ 984744 (-)
G139382 NA non-coding upstream 28599 1108550 ~ 1108876 (-)
G139405 NA non-coding upstream 80095 1160046 ~ 1160265 (-)
G139406 NA non-coding upstream 80441 1160392 ~ 1160644 (-)
G139409 NA non-coding upstream 130295 1210246 ~ 1210464 (-)
G139117 NA other downstream 840857 234212 ~ 237579 (-)
CI01000027_00131884_00132650 NA other downstream 944634 131395 ~ 132650 (-)
CI01000027_00108990_00118237 NA other downstream 960133 108119 ~ 118408 (-)
CI01000027_01241417_01245177 NA other upstream 164684 1240478 ~ 1246267 (-)
CI01000027_01303308_01319462 NR2F5, NR2F1, NR2F1.L, NR2F2 other upstream 222083 1302034 ~ 1321178 (-)
CI01000027_02119227_02124423 NA other upstream 1042179 2119131 ~ 2125142 (-)
CI01000027_02226447_02227499 NA other upstream 1146674 2225781 ~ 2227499 (-)
G140118 NA other upstream 2421583 3509352 ~ 3584679 (-)

Expression


Co-expression Network