G147350


Basic Information

Item Value
gene id G147350
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 4391588 ~ 4391916 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU167368
TGAATCTTTCAATGATGTTATGCACTGTAGATGATGAGATTTGCAAAGCCTTTGCAATTTGATGTTGAGGAACATTGTTTTCCACAATCTTTTTATGCACTCTTTCACAGATTGGAGAGCCTATGCCCATCTTTACTTCTGAGAGACTCTGCCTCTCTAAGCCATCCCTTTTATAGCTAATCATGTTACAGACCTGATATCAATTAACTTAATTAGTTGCTAGATGTTCTCCCAGCTGAATCTTTTCAAAATGTCTTGCTTTTTCAGCCATTTGTTGCCCCCGTGTCAACTTTTTTGAGACCTGTAGCAGGCATCAAATTTGAAATGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU167368 True 329 lncRNA 0.38 1 4391588 4391916

Neighbor

gene id symbol gene type direction distance location
CI01000028_04240962_04247433 NA coding upstream 143166 4240122 ~ 4248422 (+)
CI01000028_04224432_04233899 NA coding upstream 157376 4224226 ~ 4234212 (+)
CI01000028_04216684_04219734 NA coding upstream 171811 4215386 ~ 4219777 (+)
CI01000028_04145294_04156879 NA coding upstream 232935 4144943 ~ 4158653 (+)
CI01000028_03946366_03958585 NA coding upstream 431765 3944521 ~ 3959823 (+)
CI01000028_04441930_04444388 TTC36 coding downstream 49950 4441866 ~ 4444480 (+)
CI01000028_04729544_04888382 CNTN5 coding downstream 337628 4729544 ~ 4888382 (+)
CI01000028_05039088_05063207 NA coding downstream 647172 5039088 ~ 5063207 (+)
CI01000028_05114584_05116494 RNF7, RBX2 coding downstream 721602 5113518 ~ 5117062 (+)
CI01000028_05120588_05127452 GRK7B coding downstream 728267 5120183 ~ 5129029 (+)
G147343 NA non-coding upstream 26994 4364212 ~ 4364594 (+)
G147327 NA non-coding upstream 74311 4316775 ~ 4317277 (+)
G146931 NA non-coding upstream 120848 4270476 ~ 4270740 (+)
G146927 NA non-coding upstream 133936 4257180 ~ 4257652 (+)
G147356 NA non-coding downstream 13455 4405371 ~ 4405695 (+)
G147359 NA non-coding downstream 20232 4412148 ~ 4412350 (+)
G147363 NA non-coding downstream 46138 4438054 ~ 4438299 (+)
G147364 NA non-coding downstream 46846 4438762 ~ 4438984 (+)
G147366 NA non-coding downstream 47545 4439461 ~ 4439663 (+)
G145843 NA other upstream 1367368 3023146 ~ 3024220 (+)
CI01000028_00525538_00533862 NA other upstream 3869657 524647 ~ 535245 (+)
G147462 NA other downstream 566787 4958703 ~ 4989838 (+)
G147636 NA other downstream 824174 5216090 ~ 5216611 (+)
G147693 NA other downstream 1048538 5440454 ~ 5453610 (+)
CI01000028_07470324_07471346 NA other downstream 3077976 7469543 ~ 7471432 (+)
CI01000028_08302370_08504940 SPON1, SPON1A other downstream 3910331 8302247 ~ 8504940 (+)

Expression


Co-expression Network