G150963


Basic Information

Item Value
gene id G150963
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 9353128 ~ 9353379 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU171433
GAAACAGTGACACACTGGCAATCAAAATTATCCAGAGAGCCCAGTAGCATTCACAGTATGAAGGACTGGTGGGAGAACAAAGGAGGATGGGAAGGAACATCATTGTTGTTTGACTATCCTTGATCAGGTCTGTACACCATGACCTGACCTGCTAGACAAACCACTTGATAACTGTGAGAACGTGTTGTTTGTAGATGGCTCTGCCTTTAGACACAAAACAACAGGCCTGAATTGCGAAGGATAAGTTGTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU171433 True 252 lncRNA 0.44 1 9353128 9353379

Neighbor

gene id symbol gene type direction distance location
CI01000028_09309487_09309859 NA coding upstream 42907 9308812 ~ 9310221 (+)
CI01000028_09237132_09261831 NA coding upstream 91137 9236922 ~ 9261991 (+)
CI01000028_09071285_09094934 NA coding upstream 258144 9070949 ~ 9094984 (+)
CI01000028_09008686_09011637 NA coding upstream 341324 9006400 ~ 9011804 (+)
CI01000028_08899947_08900924 MAF coding upstream 452173 8899530 ~ 8900955 (+)
CI01000028_09393014_09393339 NA coding downstream 39635 9393014 ~ 9393480 (+)
CI01000028_09420414_09428472 CENPN coding downstream 66057 9419436 ~ 9428829 (+)
CI01000028_09438121_09447264 ATMIN coding downstream 84566 9437945 ~ 9447469 (+)
CI01000028_09455235_09456745 NA coding downstream 101856 9455235 ~ 9456778 (+)
CI01000028_09517515_09519873 GSE1 coding downstream 164136 9517515 ~ 9520051 (+)
G150962 NA non-coding upstream 1763 9351091 ~ 9351365 (+)
G150957 NA non-coding upstream 10952 9341912 ~ 9342176 (+)
G150821 NA non-coding upstream 27291 9318397 ~ 9325837 (+)
G150817 NA non-coding upstream 38156 9314700 ~ 9314972 (+)
G150815 NA non-coding upstream 39643 9313204 ~ 9313485 (+)
G150959 NA non-coding downstream 15726 9369105 ~ 9369505 (+)
G150991 NA non-coding downstream 18814 9372193 ~ 9372574 (+)
G151008 NA non-coding downstream 55975 9409354 ~ 9410095 (+)
G151009 NA non-coding downstream 57319 9410698 ~ 9410916 (+)
G151010 NA non-coding downstream 58058 9411437 ~ 9411809 (+)
G150398 NA other upstream 561008 8791735 ~ 8792120 (+)
CI01000028_08302370_08504940 SPON1, SPON1A other upstream 920576 8302247 ~ 8504940 (+)
CI01000028_07470324_07471346 NA other upstream 1882428 7469543 ~ 7471432 (+)
G147693 NA other upstream 3899518 5440454 ~ 5453610 (+)
G147636 NA other upstream 4136517 5216090 ~ 5216611 (+)
CI01000028_09661097_09682326 NA other downstream 319748 9660747 ~ 9684876 (+)

Expression


Co-expression Network