G151029


Basic Information

Item Value
gene id G151029
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 9513717 ~ 9513945 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU171517
TTTGCCTTTTCCTTTCTCTTATTTTGTTTGTGGAACTTTACATGAAGATTTTATGTAATTTCATTCCTGTAGAGGTTCTGTCTGTTTTGTCTTTATCTGTTCATTGTTTGATACATTATAATAAAAAAAATAAAATAAAAAAAGTTAAGAAGTTAATCACAAACTCTGTATCAAATAAACTCTGTGTTTATTCTGAGCGTTGTGAGCCCACTAAACCTGAGGCCCATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU171517 True 229 lncRNA 0.30 1 9513717 9513945

Neighbor

gene id symbol gene type direction distance location
CI01000028_09455235_09456745 NA coding upstream 56939 9455235 ~ 9456778 (+)
CI01000028_09438121_09447264 ATMIN coding upstream 66248 9437945 ~ 9447469 (+)
CI01000028_09420414_09428472 CENPN coding upstream 84888 9419436 ~ 9428829 (+)
CI01000028_09393014_09393339 NA coding upstream 120237 9393014 ~ 9393480 (+)
CI01000028_09309487_09309859 NA coding upstream 203496 9308812 ~ 9310221 (+)
CI01000028_09517515_09519873 GSE1 coding downstream 3570 9517515 ~ 9520051 (+)
CI01000028_09661097_09682326 NA coding downstream 146802 9660747 ~ 9684876 (+)
CI01000028_09715717_09725995 NA coding downstream 201772 9715717 ~ 9726018 (+)
CI01000028_09734656_09750703 GSE1 coding downstream 219036 9732981 ~ 9751123 (+)
CI01000028_09798069_09800552 COX4I1 coding downstream 284124 9798069 ~ 9800598 (+)
G151010 NA non-coding upstream 101908 9411437 ~ 9411809 (+)
G151009 NA non-coding upstream 102801 9410698 ~ 9410916 (+)
G151008 NA non-coding upstream 103622 9409354 ~ 9410095 (+)
G150991 NA non-coding upstream 141143 9372193 ~ 9372574 (+)
G150959 NA non-coding upstream 144212 9369105 ~ 9369505 (+)
G151050 NA non-coding downstream 279019 9792964 ~ 9793174 (+)
G151060 NA non-coding downstream 286989 9800934 ~ 9802018 (+)
G151063 NA non-coding downstream 293251 9807196 ~ 9807690 (+)
G150398 NA other upstream 721597 8791735 ~ 8792120 (+)
CI01000028_08302370_08504940 SPON1, SPON1A other upstream 1081165 8302247 ~ 8504940 (+)
CI01000028_07470324_07471346 NA other upstream 2043017 7469543 ~ 7471432 (+)
G147693 NA other upstream 4060107 5440454 ~ 5453610 (+)
G147636 NA other upstream 4297106 5216090 ~ 5216611 (+)

Expression


Co-expression Network