G154366


Basic Information

Item Value
gene id G154366
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 4963348 ~ 4963568 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU175263
CCCCGCCCCCGGGAACACGCAACAAAGGGGACAAGGCCATGTTGGGCTGCTTTAGAGAACAGGAAGAGTTGTTGTAATAGAGTGTTGTTGCCATGCTGTCATTTTACGCCGGACTGCTTCACAAACGAGGGTCAATTCAACGCTGGATTTGCACAAAAGATTAACAAGACGGCACATGCTAGTCGATGAGTTGAATCAACTCCACAGCAACTACATAAATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU175263 True 221 lncRNA 0.48 1 4963348 4963568

Neighbor

gene id symbol gene type direction distance location
CI01000029_04590418_04605290 NA coding upstream 357654 4590284 ~ 4605694 (+)
CI01000029_04521600_04521771 NA coding upstream 440597 4521600 ~ 4522751 (+)
CI01000029_04478628_04483582 NA coding upstream 479747 4476420 ~ 4483601 (+)
CI01000029_04409794_04419021 OPN8B coding upstream 544327 4409794 ~ 4419021 (+)
CI01000029_04389599_04399047 OPN8A coding upstream 564283 4389599 ~ 4399065 (+)
CI01000029_04981453_04995255 NA coding downstream 17577 4981145 ~ 4995662 (+)
CI01000029_05041887_05044363 NA coding downstream 77429 5040997 ~ 5045063 (+)
CI01000029_05104260_05107686 BMP2B coding downstream 139651 5103219 ~ 5107804 (+)
CI01000029_05232703_05233677 TAAR11 coding downstream 266624 5230192 ~ 5234070 (+)
CI01000029_05267765_05268790 TAAR64, TAAR13E, TAAR13D, TAAR13C, TAAR13B coding downstream 304122 5267690 ~ 5268884 (+)
G154361 NA non-coding upstream 3640 4959495 ~ 4959708 (+)
G154360 NA non-coding upstream 9438 4953703 ~ 4953910 (+)
G154358 NA non-coding upstream 13783 4949304 ~ 4949565 (+)
G154353 NA non-coding upstream 22645 4940467 ~ 4940703 (+)
G154352 NA non-coding upstream 31110 4931979 ~ 4932238 (+)
G154368 NA non-coding downstream 9610 4973178 ~ 4973526 (+)
G154371 NA non-coding downstream 13160 4976728 ~ 4976986 (+)
G154372 NA non-coding downstream 13663 4977231 ~ 4977523 (+)
G154341 NA non-coding downstream 23194 4986762 ~ 4987398 (+)
G154378 NA non-coding downstream 42102 5005670 ~ 5005961 (+)
G153790 NA other upstream 223241 4733589 ~ 4740107 (+)
G153475 NA other upstream 1401344 3545125 ~ 3562004 (+)
G152451 NA other upstream 2200409 2761594 ~ 2762939 (+)
CI01000029_01526863_01527414 NA other upstream 3435449 1526754 ~ 1527899 (+)
G151495 NA other upstream 4591426 366541 ~ 371922 (+)
G154587 NA other downstream 307452 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 493673 5461497 ~ 5470346 (+)
G155079 NA other downstream 1319117 6282685 ~ 6288398 (+)
G155083 NA other downstream 1467967 6431535 ~ 6490294 (+)
CI01000029_06906861_06907157 NA other downstream 1942620 6905834 ~ 6908633 (+)

Expression


Co-expression Network