G156332


Basic Information

Item Value
gene id G156332
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 6688752 ~ 6689050 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU177503
CAAAAATAACAACTTTATTCAACAATCTCTTCTCTTCTGTGTCAGTCTCCTACGTTGATTAAGTCCAGTGCTTCCAGGTTCTACGTCAGAACGCTATCTCATTATTGGCCGGCTCCTGCGTCAACATCACATGCATGCATCGTGCTGCTCAATTTGATCAGCTTTGGCCAATACCGAGCCAGCATTTGGACGTAAACACGGAAGACTTCACTGTGCTTACTGCGTCACCTGCGTAGGGATAATGATTCAAAAAGAGATTGTTGAATAAAGTCGTTATTTTTGTTTTGTTTTTGCGCACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU177503 True 299 lncRNA 0.42 1 6688752 6689050

Neighbor

gene id symbol gene type direction distance location
CI01000029_06666877_06679215 NA coding downstream 9537 6666830 ~ 6679215 (-)
CI01000029_06606850_06665941 NA coding downstream 22602 6606850 ~ 6666150 (-)
CI01000029_06486658_06492567 NA coding downstream 196185 6486470 ~ 6492567 (-)
CI01000029_06449255_06451786 NAA20.S, NAA20, RIN2 coding downstream 236966 6449112 ~ 6451786 (-)
CI01000029_06431763_06439215 NA coding downstream 249537 6431720 ~ 6439215 (-)
CI01000029_06689615_06698873 NA coding upstream 487 6689537 ~ 6698873 (-)
CI01000029_06719634_06722376 NA coding upstream 30477 6719527 ~ 6723172 (-)
CI01000029_06739098_06769987 NA coding upstream 49664 6738533 ~ 6769987 (-)
CI01000029_06798103_06806327 EXTL3 coding upstream 108990 6798040 ~ 6806846 (-)
CI01000029_06832914_06833074 NDUFB1 coding upstream 143659 6831854 ~ 6833074 (-)
G156322 NA non-coding downstream 1118 6682691 ~ 6687634 (-)
G156362 NA non-coding downstream 92052 6596489 ~ 6596700 (-)
G156359 NA non-coding downstream 110259 6578261 ~ 6578493 (-)
G156358 NA non-coding downstream 110568 6577901 ~ 6578184 (-)
G156357 NA non-coding downstream 112766 6575727 ~ 6575986 (-)
G156380 NA non-coding upstream 72014 6761064 ~ 6761314 (-)
G156396 NA non-coding upstream 163074 6852124 ~ 6852324 (-)
G156400 NA non-coding upstream 171904 6860954 ~ 6861244 (-)
G154415 NA other downstream 1701327 4986108 ~ 4990990 (-)
CI01000029_04460778_04463540 FKBP1B other downstream 2211540 4460159 ~ 4463540 (-)
CI01000029_03698769_03707177 NA other downstream 2981500 3698572 ~ 3707883 (-)
G153891 NA other downstream 3402198 3248777 ~ 3286554 (-)
CI01000029_02589994_02592379 NA other downstream 4095950 2587549 ~ 2592379 (-)
G156542 NA other upstream 481317 7170367 ~ 7170951 (-)
G156495 NA other upstream 677277 7365007 ~ 7371921 (-)

Expression


Co-expression Network