G155218


Basic Information

Item Value
gene id G155218
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 6688755 ~ 6689078 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU176244
GCGCAAAAACAAAACAAAAATAACGACTTTATTCAACAATCTCTTTTTGAATCATTATCCCTACGCAGGTGACGCAGTAAGCACAGTGAAGTCTTCCGTGTTTACGTCCAAATGCTGGCTCGGTATTGGCCAAAGCTGATCAAATTGAGCAGCACGATGCATGCATGTGATGTTGACGCAGGAGCCGGCCAATAATGAGATAGCGTTCTGACGTAGAACCTGGAAGCACTGGACTTAATCAACGTAGGAGACTGACACAGAAGAGAAGAGATTGTTGAATAAAGTTGTTATTTTTGTTTTGTTTTTGCGTACAAAATGTATTCT

Function

NR:

description
uncharacterized protein LOC110014916

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU176244 True 324 lncRNA 0.41 1 6688755 6689078

Neighbor

gene id symbol gene type direction distance location
CI01000029_06494856_06495812 NA coding upstream 192908 6494391 ~ 6495847 (+)
CI01000029_06453008_06476863 NA coding upstream 211665 6453008 ~ 6477090 (+)
CI01000029_06443365_06447942 CRNKL1 coding upstream 240813 6443365 ~ 6447942 (+)
CI01000029_06347167_06348123 NA coding upstream 340586 6346660 ~ 6348169 (+)
CI01000029_06305668_06307332 NKX2.4B coding upstream 381080 6305245 ~ 6307675 (+)
CI01000029_06724205_06734079 HMBOX1B, HMBOX1 coding downstream 35127 6724205 ~ 6735582 (+)
CI01000029_06775631_06791278 INTS9 coding downstream 86553 6775631 ~ 6791346 (+)
CI01000029_06824397_06831521 CUNH14ORF169 coding downstream 134551 6823629 ~ 6832671 (+)
CI01000029_06834812_06849277 CPSF2 coding downstream 144499 6833577 ~ 6849518 (+)
CI01000029_06865685_06903896 SLC24A4, SLC24A4B coding downstream 176607 6865685 ~ 6903896 (+)
G155194 NA non-coding upstream 7787 6672937 ~ 6680968 (+)
G155193 NA non-coding upstream 81650 6603095 ~ 6607105 (+)
G155196 NA non-coding upstream 86224 6602316 ~ 6602531 (+)
G155186 NA non-coding upstream 110261 6578275 ~ 6578494 (+)
G155162 NA non-coding upstream 173777 6514727 ~ 6514978 (+)
G155236 NA non-coding downstream 203 6689281 ~ 6689937 (+)
G155248 NA non-coding downstream 32885 6721963 ~ 6722184 (+)
G155235 NA non-coding downstream 33266 6722344 ~ 6722557 (+)
G155249 NA non-coding downstream 55754 6744832 ~ 6747562 (+)
G155253 NA non-coding downstream 62209 6751287 ~ 6751778 (+)
G155083 NA other upstream 198461 6431535 ~ 6490294 (+)
G155079 NA other upstream 400357 6282685 ~ 6288398 (+)
CI01000029_05461497_05468985 BATF other upstream 1218409 5461497 ~ 5470346 (+)
G154587 NA other upstream 1417220 5271020 ~ 5271535 (+)
G153790 NA other upstream 1948648 4733589 ~ 4740107 (+)
CI01000029_06906861_06907157 NA other downstream 217110 6905834 ~ 6908633 (+)
G155522 NA other downstream 945755 7634833 ~ 7637834 (+)
G155627 NA other downstream 1242402 7931480 ~ 7932177 (+)
G156007 NA other downstream 2275740 8964818 ~ 9064541 (+)

Expression


Co-expression Network